blood RNA,RNA extraction,biospecimen,DNA extraction,protein extraction,preservative


 
     AquaPlasmid, AquaGenomic, & AquaRNA aqueous solutions for nucleic acid isolation and purification

Home | Contact | Protocols | Products | Order | FAQ Policy | MSDS | AquaPlasmid | AquaGenomic | AquaRNA | AquaBluer | AquaStool | AquaPreserve 

PROTOCOLS

 

Here you can find the latest protocols for our products. We continue to refine the protocols and expand the applications of our products. Please let us know if you have any suggestions and comments to our protocols and products.

 

 


 AquaPlasmid Protocols

AquaPlasmid protocol is similar to standard alkaline lysis protocol. Both protocols consist of four simple steps: (1) harvest the cells, (2) lyse the cells, (3) remove the debris, and (4) pellet the plasmid DNA. However, the difference is the purity of the isolated plasmid DNA. Alkaline lysis produces very "dirty" plasmid DNA, which contains large amount of protein and RNA. AquaPlasmid isolated plasmid DNA is essentially free of cellular impurities and the DNA is ready for down-stream applications.

 


AquaPlasmid Miniprep Protocol

For preparation of 5-10 ug of plasmid DNA from 1 ml overnight bacterial culture.

 

1. Harvest the Cells

 

Transfer 1 ml overnight culture to a 1.5-ml microfuge tube. Centrifuge at ~15,000xg for 30 seconds at room temperature (~22° C) to pellet the bacteria. Aspirate to discard the supernatant as completely as possible.

 

2. Lyse the Cells

 

Add 50 ul deionized water to the bacterial pellet. Vortex vigorously to fully resuspend the cells. Add 30 ul AquaLysis Solution to the cell suspension. Vortex vigorously for 10-20 seconds to mix the contents well. Incubate at room temperature for 3-4 minutes to lyse the cells.

 

3. Remove the Debris

 

Add 30 ul AquaPlasmid Solution to the crude lysate. Touch-vortex (a few seconds on and then a few seconds off) at top speed or shake vigorously 10-15 times to mix the contents. Incubate at room temperature for 3-4 minutes. Centrifuge at ~15,000xg for 5 minutes at room temperature to pellet the debris.

 

4. Pellet the Plasmid DNA

 

Transfer 100 ul clear lysate to a clean 0.5-ml microfuge tube preloaded with 30 ul of AquaPlasmid Solution. Mix the contents by vortexing vigorously for 20-30 seconds. Centrifuge at ~15,000xg for 5 minutes at room temperature to pellet the plasmid DNA. Flip the tube to discard the supernatant. Fill the tube with 70% ethanol by shooting the ethanol solution from a squeeze bottle at the cap and sidewall of the tube, and then flip to discard the ethanol. Repeat the 70% ethanol rinse 3 times. Flip the tube forcefully a few times and blot it on a paper towel to remove residual ethanol. Add 100 ul deionized water and resuspend the DNA by vortexing for 20-30 seconds. Store the DNA solution at 4° C or at –20° C for long-term storage.

 

 


AquaPlasmid Midiprep Protocol

For preparation of 50-100 ug of plasmid DNA from 10 ml bacterial culture.

 

1. Harvest the Cells

 

Transfer 10 ml overnight culture to a 40-ml centrifuge tube. Centrifuge at ~15,000xg for 1 minute at room temperature (~22° C) to pellet the bacteria. Aspirate or pour off the supernatant as completely as possible.

 

2. Lyse the Cells

 

Add 500 ul deionized water to the bacterial pellet. Vortex vigorously to fully resuspend the cells. Transfer the cell suspension to a 2-ml microfuge tube. Add 300 ul AquaLysis Solution to the cell suspension. Vortex vigorously for 10-20 seconds to mix the contents. Incubate at room temperature for 3-4 minutes to lyse the cells.

 

3. Remove the Debris

 

Add 300 ul AquaPlasmid Solution to the crude lysate. Vortex vigorously 10-20 seconds to mix the contents and shake to break up the large white aggregates. Incubate at room temperature for 3-4 minutes. Centrifuge at ~15,000xg for 5 minutes at room temperature to pellet the debris.

 

4. Pellet the Plasmid DNA

 

Transfer 1 ml clear lysate to a clean 2-ml microfuge tubes preloaded with 300 ul AquaPlasmid Solution. Mix the contents by vortexing vigorously for 20-30 seconds. Centrifuge at ~15,000xg for 5-10 minutes at room temperature to pellet the plasmid DNA. Flip the tube to discard the supernatant. Fill the tube with 70% ethanol by shooting the ethanol solution from a squeeze bottle at the cap and sidewall of the tube, and then flip to discard the ethanol. Repeat the 70% ethanol rinse 3 times. Flip the tube forcefully a few times and blot it on a paper towel to remove residual ethanol. Add 500 ul deionized water and resuspend the DNA by vortexing for 30-60 seconds. Store the DNA solution at 4° C or at –20° C for long-term storage.

 

 


AquaPlasmid Maxiprep Protocol

For preparation of 500-1000 ug of plasmid DNA from 100 ml bacterial culture.

 

1. Harvest the Cells

 

Transfer 100 ml overnight culture to a 250-ml centrifuge bottle. Centrifuge at ~15,000xg for 2 minutes at room temperature (~22° C) to pellet the bacteria. Aspirate or pour off the supernatant as completely as possible.

 

2. Lyse the Cells

 

Add 5 ml deionized water to the bacterial pellet. Vortex vigorously to fully resuspend the cells. Add 3 ml AquaLysis Solution to the cell suspension. Shake to mix the contents well and the vortex vigorously for 20-30 seconds. Rotate the contents along the sidewall to wet the area that may retain residual cell suspension. Incubate at room temperature for 3-4 minutes to lyse the cells.

 

 3. Remove the Debris

 

Add 3 ml AquaPlasmid Solution to the crude lysate. Gently shake and rotate the contents along the sidewall to mix well. Vortex vigorously for 20-30 seconds to break up the large white aggregates. Incubate at room temperature for 3-4 minutes. Centrifuge at ~15,000xg for 5 minutes at room temperature to pellet the debris.

 

4. Pellet the Plasmid DNA

 

Transfer 10 ml clear lysate to a 40-ml centrifuge tube preloaded with 3 ml of AquaPlasmid Solution. Mix the contents by vortexing vigorously for 20-30 seconds. Centrifuge at ~15,000xg for 10 minutes at room temperature to pellet the plasmid DNA. Pour off the supernatant. A white DNA pellet should be visible. Fill the tube with 70% ethanol to about half full by shooting the ethanol solution from a squeeze bottle along the sidewall of the tube, and then rotate the ethanol solution to rinse the entire tube while slowly pouring off the ethanol (Ensure that the DNA pellet remains attached before pouring off the ethanol!). Repeat the 70% ethanol rinse 3 times. Tap the tube on a paper towel to remove residual ethanol. Add 1 ml deionized water to the DNA pellet and fully suspend the pellet by pipetting the solution up and down. Transfer the DNA solution to a 1.5-ml microfuge tube and centrifuge at ~15,000xg for 5 minutes to pellet any insoluble. Transfer the clear DNA solution to another clean tube. Store the DNA solution at 4° C or at –20° C for long-term storage.

 

 

 


 

AquaPlasmid 96-Well Plate Protocol

 

This protocol can be used to prepare miniprep DNA in 96-well high-throughput format. It yields 5-10 ug of plasmid DNA per well.

 

1. Harvest the Cells

 

Grow the bacteria in 0.5-1 ml overnight culture in 96-well deep-well (1-2 ml) plate in a 37° C shaker overnight. The plate should be sealed with a microporus tape. Centrifuge the overnight bacterial culture in bucket rotors that hold deep-well plates at allowed maximal speed (>1,000xg) for 15 minutes at room temperature (~22° C) to pellet the bacteria. Aspirate to remove the medium. If only rotors for standard microtiter plates are available, standard 48-well plates can be used to grow the bacteria in 0.5 ml culture medium.

 

2. Lyse the Cells

 

Add 50 ul deionized water to each well. Shake the plate by hands or on a plate shaker at top speed to fully resuspend the cells. Add 30 ul AquaLysis Solution to each well. Shake the plate by hands or on the shaker at top speed for 10-20 seconds to mix the contents. Incubate at room temperature for 3-4 minutes to lyse the cells.

 

3. Remove the Debris

 

Add 30 ul AquaPlasmid Solution to each well. Shake the plate by hands or on the shaker for 20-30 seconds to mix the contents. Incubate at room temperature for ~5 minutes. Centrifuge the plate at allowed maximal speed for 15 minutes at room temperature to pellet the debris.

 

4. Pellet the Plasmid DNA

 

Carefully transfer 100 ul clear lysate to corresponding well in a clean plate. Add 30 ul AquaPlasmid Solution to each well. Shake the plate by hands or on a plate shaker at top speed for 1-2 minutes to mix the contents. Centrifuge the plate at allowed maximal speed for 15 minutes at room temperature to pellet the plasmid DNA. Flip the plate to discard the supernatant. Fill the wells with 70% ethanol to ~80% full by gently shooting the ethanol solution from a squeeze bottle at the sidewall of the wells, and then flip the plate to discard the ethanol. Repeat the 70% ethanol rinse 3 times. Flip the plate forcefully a few times and blot it on a paper towel to remove residual ethanol. Add 100 ul deionized water to each well. Shake the plate by hands or on a plate shaker at top speed for 1-2 minutes to resuspend the DNA. Store the DNA solution at 4° C or at –20° C for long-term storage.

 

 


 AquaGenomic Protocols

The uniqueness of AquaGenomicTM is its ability to perform multiple functions in a single step: suspending the cells, lysing the cells, extracting the DNA, and precipitating the cell debris. The AquaGenomic protocols consist of four simple steps: (1) harvest the cells, (2) extract the DNA, (3) pellet the debris, and (4) pellet the DNA.

 


AquaGenomic Cell Protocol

This protocol can be used to prepare 5-10 ug of genomic DNA from 1-2 million cultured cells. For other preparation scales, use 100 ul AquaGenomic Solution for each million nucleated cells. 

 

1. Harvest the Cells

 

Pellet ~0.5-2 million cultured cells in a 1.5-ml microfuge tube by centrifugation at 2,000xg for 2 minutes. Aspirate or decant to discard the supernatant.

 

2. Extract the DNA

 

Add 100 ul of AquaGenomic Solution to the cell pellet. Suspend and lyse the cells by vortex vigorously for 30-60 seconds. Incubate at room temperature for 15 minutes (or at 65° C for 15 min to produce better lysis and inactivate any residual DNases).

 

3. Pellet the Debris

 

Vortex vigorously for 30-60 seconds and centrifuge the sample at 10,000-20,000xg for 4 minutes to pellet the debris.

 

4. Pellet the DNA

 

Transfer the supernatant (~90 ul) to a fresh 0.5-ml microfuge tube. Add 1 volume of 100% isopropanol and mix by vortexing for 30 seconds. Centrifuge at 10,000-20,000xg for 2 minutes to pellet the DNA. Flip the tube to discard the supernatant. Fill the microfuge tube with 70% ethanol by shooting the ethanol solution at the cap of the tube from a squirt bottle, and then flip to discard the ethanol. Repeat the 70% ethanol rinse 3 times. Air-dry the DNA pellet. Add 50 ul of TE buffer or deionized water, pipette up-and-down and vortex vigorously to suspend the DNA. Incubate at 22 °C for 15 min to solubilize the DNA and then centrifuge for 2 minutes to pellet any insoluble (optional: transfer the clear DNA solution to a new tube).

 

 

 


 

AquaGenomic Blood Protocol

 

(We recommend AquaPreserve Blood Protocol for DNA, RNA, and protein extraction from blood specimens. It is much simpler and does not require the removal of red blood cells, therefore, minimizes white blood cell lysis and DNA, RNA, and protein loss during the red blood cell lysis step. However, AquaGenomic protocol does not involve the use of any toxic chemical and it is the choice of many users.)

 

This protocol can be used to prepare ~5-6 ug of genomic DNA from 100 ul of whole blood (fresh or frozen). It requires a RBC Lysis Solution (Product # 4015, not included) to lyse the red blood cells prior to DNA extraction. 

 

1. Harvest the Cells

 

Add 50 ul of RBC Lysis Solution to 100 ul whole blood. Mix the contents by touch-vortex (a few seconds on and a split second off) for 20-30 times at top speed to lyse the red blood cells. Add 1 ml deionized water and vortex to wash the cells. Centrifuge at 10,000-20,000xg for 1 minute to pellet the white blood cells and nuclei. Aspirate to remove the supernatant. Add 1 ml deionized water to the cell pellet, vortex to wash the pellet, and centrifuge to pellet the cells. Aspirate to remove the supernatant. (Note: If the blood specimen is fresh and has not been frozen, the RBC may be lysed with 10 volumes of deionized water without using the RBC Lysis Solution.)

 

2. Extract the DNA

 

Add 100 ul of AquaGenomic Solution to the cell pellet. Suspend and lyse the cells by pipetting and vortex. Incubate at room temperature for 15 minutes (or at 65° C for 15 min to produce better lysis and inactivate any residual DNases).

 

3. Pellet the Debris

 

(Optional: Add 5 ul 100% isopropanol to the sample and vortex to reduce foaming and allow the debris pellet become tighter following centrifugation.) Vortex vigorously for 30-60 seconds and centrifuge at 10,000-20,000xg for 4 minutes to pellet the debris.

 

4. Pellet the DNA

 

Transfer the supernatant (~90 ul) to a fresh 0.5-ml microfuge tube. Add 1 volume of 100% isopropanol and mix by vortexing for 30 seconds. Centrifuge at 10,000-20,000xg for 2 minutes to pellet the DNA. Flip the tube to discard the supernatant. Fill the microfuge tube with 70% ethanol by shooting the ethanol solution at the cap of the tube from a squirt bottle, and then flip to discard the ethanol. Repeat the 70% ethanol rinse 3 times. Air-dry the DNA pellet. Add 50 ul of TE buffer or deionized water, pipette up-and-down and vortex vigorously to suspend the DNA. Incubate at 22 °C for 15 min to solubilize the DNA and then centrifuge for 2 minutes to pellet any insoluble (optional: transfer the clear DNA solution to a new tube).

 

 

 


AquaGenomic 96-Well Plate Blood Protocol

 

This protocol requires the use of a bucket rotor that hold 96-well plates (1 or 2-ml deep-well plates) with a relative centrifugation force >3,000xg, such as Beckman S5700. Make sure your plates can sustain the required RCF. 

 

1. Harvest the Cells

 

Load 100 ul whole blood into each of the 96 wells. Add 50 ul of RBC Lysis Solution (Product # 4015) to each well. Seal the plate with an adhesive cover. Shake the plate on a plate shaker at top speed for one minute to lyse the red blood cells (RBC). Add 1 ml deionized water to each well and shake the plate for one minute to wash the cells. Centrifuge the plate at allowed maximal speed (>3,000xg) for 5 minutes to pellet the white blood cells and nuclei. Aspirate to remove the red supernatant. Add 1 ml deionized water to the pellet, shake the plate for a minute to wash the pellet, centrifuge for 5 minutes to pellet the cells, and aspirate to remove the supernatant.

 

2. Extract the DNA

 

Add 100 ul of AquaGenomic Solution to each well. Pipette up-and-down and shake the plate vigorously for 2 minutes to suspend and lyse the cells. Incubate the plate at room temperature for 5 minutes.

 

3. Pellet the Debris

 

Centrifuge the plate at allowed maximal speed for 15 minutes at room temperature to pellet the cell debris.

 

4. Pellet the DNA

 

Transfer the supernatant (~90 ul) to corresponding well in a fresh plate. Add 1 volume of 100% isopropanol and mix the contents by shaking for 30 seconds. Centrifuge at allowed maximal speed for 15 minutes to pellet the DNA. Flip to discard the supernatant. Fill the wells with 70% ethanol, and then flip to discard the ethanol. Repeat the 70% ethanol rinse 3 times. Flip the plate and blot it several times on a paper towel to remove residual ethanol. Air-dry the DNA pellet. Air-dry the DNA pellet. Add 50 ul of TE buffer or deionized water and shake vigorously to suspend the DNA. Store the DNA solution at 4° or at –20° C for long-term storage.

 

 


AquaGenomic Swab Protocol

This protocol can be used to prepare 5-10 ug of genomic DNA from one buccal swab. It is a simple, fast, and non-invasive method to obtain genomic DNA from individuals for epidemiological, pharmacogenomic, genealogical, paternal, and forensic studies. 

 

1. Harvest the Cells

 

Swirl and rub your tongue against the inside of your cheek and gum for ~5-10 times. Subsequently place a sterile cotton tipped swab into your mouth. Move the swab around the mouth 10-20 times to rub different areas along the cheek-gum juncture and soak up the saliva. Swabs may also be used to collect cells from animals, tissue cultures, and forensic items to obtain genomic DNA.

 

2. Extract the DNA

 

For fresh wet swab: Immediately place the wet swab into a 1.5-ml microfuge tube preloaded with 200 ul of AquaGenomic Solution. For dry swab: Soak the dry swab in 400 ul of AquaGenomic Solution in a 1.5-ml microfuge tube for 15 minutes. Loosely rotate the swab back-and-forth as well as pump it up-and-down 10-20 times in the solution. Squeeze off as much as possible the liquid from the cotton tip against the wall of the tube. Discard the swab. Incubate at room temperature for 15 minutes (or at 65° C for 15 min to produce better lysis and inactivate any residual DNases).

 

3. Pellet the Debris

 

Vortex the sample vigorously for 30-60 seconds and centrifuge at 10,000-20,000xg for 4 minutes to pellet the debris.

 

4. Pellet the DNA

 

Transfer the supernatant (~180 ul) to a fresh 0.5-ml microfuge tube. Add 1 volume of 100% isopropanol and mix by vortexing for 30 seconds. Centrifuge at 10,000-20,000xg for 2 minutes to pellet the DNA. Flip the tube to discard the supernatant. Fill the microfuge tube with 70% ethanol by shooting the ethanol solution at the cap of the tube from a squirt bottle, and then flip to discard the ethanol. Repeat the 70% ethanol rinse 3 times. Air-dry the DNA pellet. Add 50 ul of TE buffer or deionized water, pipette up-and-down and vortex vigorously to suspend the DNA. Incubate at 22 °C for 15 min to solubilize the DNA and then centrifuge for 2 minutes to pellet any insoluble (optional: transfer the clear DNA solution to a new tube).

 

 

 


 

AquaGenomic Saliva Protocol

 

Saliva is one of the most accessible sources of genomic DNA from human subjects. About 10 ug of genomic DNA can be readily extracted from 50 ul saliva using 100 ul of AquaGenomic Solution. 

 

1. Harvest the Cells

 

Swirl and rub your tongue against the inside of your cheek and gum for ~5-10 times. Carefully spit the saliva into a clean weight boat or a piece of weight paper.

 

2. Extract the DNA

 

Transfer 50 ul of saliva to a 0.6-ml microfuge tube preloaded with 100 ul of AquaGenomic Solution. Vortex the tube vigorously for 30-60 seconds. Incubate at room temperature for 15 minutes (or at 65° C for 15 min to produce better lysis and inactivate any residual DNases).

 

3. Pellet the Debris

 

Vortex the tube vigorously for 30 seconds and centrifuge the sample at 10,000-20,000xg for 4 minutes to pellet the debris.

 

4. Pellet the DNA

 

Transfer the supernatant (~120 ul) to a fresh 0.6-ml microfuge tube. Add 1 volume (~120) of 100% isopropanol and mix by vortexing for 30 seconds. Centrifuge at 10,000-20,000xg for 2 minutes to pellet the DNA. Flip the tube to discard the supernatant. Fill the microfuge tube with 70% ethanol from a squirt bottle, and then flip to discard the ethanol solution. Repeat the ethanol rinse 3 times. Air-dry the DNA pellet. Add 50 ul of TE buffer or deionized water, pipette up-and-down and vortex vigorously to suspend the DNA. Incubate at 22 °C for 15 min to solubilize the DNA and then centrifuge for 2 minutes to pellet any insoluble (optional: transfer the clear DNA solution to a new tube).

 

 

 


AquaGenomic Tissue Protocol  

DNA may be extracted from tissues by homogenization or by Proteinase K digestion in AquaGenomic solution. About 10-20 ug of DNA can be isolated from 10 mg of tissue. 

 

1. Harvest the Cells 

 

Cut out a ~2 mm cube (~10 mg) of frozen or fresh tissue.

 

2. Extract the DNA

 

By homogenization: Place the tissue in a pestle-and-tube homogenizer and homogenize in 100 ul of AquaGenomic solution at room temperature. After homogenization, add 1/10 volume (~10 ul) of 100% isopropanol to the sample to reduce forming. Briefly vortex and immediately transfer the sample into a 1.5-ml microfuge tube. Incubate at room temperature for 15 minutes (or at 65° C for 15 min to produce better lysis and inactivate any residual DNases).

 

By Proteinase K digestion: Place the tissue in a microfuge tube preloaded with 100 ul of AquaGenomic solution containing 10 ug of Proteinase K. Incubate at 60-65 °C for 90 minutes and then at 95 °C for 10 minutes to inactivate the Proteinase K. The tissue is readily disintegrated by vortexing vigorously or pipetting.

 

3. Pellet the debris

 

Vortex the sample vigorously for 30-60 seconds and centrifuge at 10,000-20,000xg for 4 minutes to pellet the debris.

                                                                                    .

4. Pellet the DNA

 

Transfer the supernatant (~90 ul) to a fresh 0.5-ml microfuge tube. Add 1 volume of 100% isopropanol and mix by vortexing for 30 seconds. Centrifuge at 10,000-20,000xg for 2 minutes to pellet the DNA. Flip the tube to discard the supernatant. Fill the microfuge tube with 70% ethanol by shooting the ethanol solution at the cap of the tube from a squirt bottle, and then flip to discard the ethanol. Repeat the 70% ethanol rinse 3 times. Air-dry the DNA pellet. Add 50 ul of TE buffer or deionized water, pipette up-and-down and vortex vigorously to suspend the DNA. Incubate at 22 °C for 15 min to solubilize the DNA and then centrifuge for 2 minutes to pellet any insoluble (optional: transfer the clear DNA solution to a new tube).

 

 


 AquaGenomic Tail Protocol

Mouse tail is fibrous, Proteinase K (not supplied) is added to AquaGenomic solution to assist the disintegration of the tissue. However, if Proteinase K is not used, overnight incubation is needed. This protocol uses 100 ul of AquaGenomic solution to prepare 15-20 ug of DNA from ~10 mg (~2 mm) tail snip

 

1. Harvest the Tissue

 

Cut off approximately 2 mm long fresh or frozen mouse tail. Place the tissue into a microfuge tube preloaded with 100 ul of AquaGenomic solution containing 10 ug of Proteinase K (e.g., add 2 ul of 5 mg/ml Proteinase K stock solution to 100 ul of AquaGenomic solution just before the extraction).

 

2. Extract the DNA

 

Incubate at 65 °C for 2 hours and then at 95 °C for 10 minutes to inactivate the Proteinase K. The tissue is readily disintegrated by vortexing vigorously or pipetting.

 

3. Pellet the Debris

 

Centrifuge at 12,000-20,000xg for 4 minutes to pellet the debris.

 

4. Pellet the DNA

 

Transfer the supernatant (~90 ul) to a fresh 0.5-ml microfuge tube. Add 1 volume of 100% isopropanol and mix by vortexing for 30 seconds. Centrifuge at 10,000-20,000xg for 2 minutes to pellet the DNA. Flip the tube to discard the supernatant. Fill the microfuge tube with 70% ethanol by shooting the ethanol solution at the cap of the tube from a squirt bottle, and then flip to discard the ethanol. Repeat the 70% ethanol rinse 3 times. Air-dry the DNA pellet. Add 50 ul of TE buffer or deionized water, pipette up-and-down and vortex vigorously to suspend the DNA. Incubate at 22 °C for 15 min to solubilize the DNA and then centrifuge for 2 minutes to pellet any insoluble (optional: transfer the clear DNA solution to a new tube).

 

 

 


AquaGenomic Plant Protocol

 

This protocol may be used to isolate ~10-20 ug of genomic DNA from 20 mg of plant tissues, using 200 ul AquaGenomic Solution.

 

1. Harvest the Cells

 

Weigh out ~20 mg of fresh or frozen plant tissue. Cut the tissue into small pieces. Place them in 200 ul of AquaGenomic Solution in a pestle-and-tube homogenizer.

 

2. Extract the DNA

 

Homogenize the tissue at room temperature. Move the pestle up and down while vortexing at miximal speed to enhance homogenization. After homogenization, add 1/10 volume (~30 ul) of 100% isopropanol to the sample to reduce forming. Briefly vortex and immediately pour the sample into a 1.5-ml microfuge tube.

 

3. Pellet the debris

 

Centrifuge at 10,000-20,000xg for 4 minutes to pellet the debris.

                                                                                    .

4. Pellet the DNA

 

Transfer the supernatant (~90 ul) to a fresh 0.5-ml microfuge tube. Add 1 volume of 100% isopropanol and mix by vortexing for 30 seconds. Centrifuge at 10,000-20,000xg for 2 minutes to pellet the DNA. Flip the tube to discard the supernatant. Fill the microfuge tube with 70% ethanol by shooting the ethanol solution at the cap of the tube from a squirt bottle, and then flip to discard the ethanol. Repeat the 70% ethanol rinse 3 times. Air-dry the DNA pellet. Add 50 ul of TE buffer or deionized water, pipette up-and-down and vortex vigorously to suspend the DNA. Incubate at 22 °C for 15 min to solubilize the DNA and then centrifuge for 2 minutes to pellet any insoluble (optional: transfer the clear DNA solution to a new tube).

 

 

 


 AquaGenomic Microbe Protocol

 

This protocol can be used to prepare ~10-20 ug of genomic DNA from 1 ml overnight microbial culture. For other preparation scales, use 100 ul of AquaGenomic Solution for each milliliter of overnight culture.

 

1. Harvest the Cells

 

Centrifuge 1 ml overnight bacterial culture at 10,000-20,000xg for 30 seconds to pellet the cells. Aspirate to discard the medium and leave behind the cell pellet.

 

2. Extract the DNA

 

For Gram-negative bacteria: Add 100 ul of AquaGenomic Solution to the cell pellet. Suspend the cells by vortexing vigorously for 30 seconds. Incubate the sample at 65° C for 15 minutes to lyse the cells (For some strains, cell lysis and DNA yield may be enhanced by incubating at 90° C for 30 minutes).

 

For Gram-positive bacteria or yeast: Treat the bacterial or yeast cells with lysozyme or lyticase (not supplied) according the enzyme manufactures’ instruction. Add ~50 ul of 0.5-1 mm glass beads and 100 ul of AquaGenomic Solution to the sample. Vortex briefly and incubate the sample at 65° C for 15 minutes to lyse the cells (For some strains, cell lysis and DNA yield may be enhanced by incubating at 90° C for 30 minutes).

 

3. Pellet the Debris

 

Vortex the sample vigorously for 30-60 seconds and centrifuge at 10,000-20,000xg for 4 minutes to pellet the debris.

 

4. Pellet the DNA

 

Transfer the supernatant (~90 ul) to a fresh 0.5-ml microfuge tube. Add 1 volume of 100% isopropanol and mix by vortexing for 30 seconds. Centrifuge at 10,000-20,000xg for 2 minutes to pellet the DNA. Flip the tube to discard the supernatant. Fill the microfuge tube with 70% ethanol by shooting the ethanol solution at the cap of the tube from a squirt bottle, and then flip to discard the ethanol. Repeat the 70% ethanol rinse 3 times. Air-dry the DNA pellet. Add 50 ul of TE buffer or deionized water, pipette up-and-down and vortex vigorously to suspend the DNA. Incubate at 22 °C for 15 min to solubilize the DNA and then centrifuge for 2 minutes to pellet any insoluble (optional: transfer the clear DNA solution to a new tube).

 

 

 


AquaGenomic Stool and Soil Protocol

 

 

This protocol uses 150 ul of AquaGenomic Solution to prepare 5-10 ug of DNA from 15 mg of feces. Isolation of pure DNA from feces or soil is difficult due to the presence of large amount of enzyme inhibitors in these samples. The protocol uses AquaPrecipi solution (Item # 3015, not included, to remove these PCR inhibitors). 

 

1. Harvest the Cells

 

Weigh out 15 mg of wet feces (~10 mg of dry fecal pellet) or 30 mg of soil in a 1.5-ml microfuge tube.

 

2. Extract the DNA

 

Add 150 ul of AquaGenomic solution (If mitochondrial DNA extraction is desired, add Proteinase K to AquaGenomic to 100 ug/ml. Incubate at 60-65 °C for 90 minutes to digest the mitochondria and then at 95 °C for 10 minutes to inactivate the Proteinase K.) to the sample. For dry fecal sample, let it soak in AquaGenomic Solution until it is rehydrated. Homogenize the sample with a microfuge pestle or bead beater or just vortex vigorously for 1-2 minutes. Incubate the sample at 60-80° C for 15-30 minutes.

 

3. Pellet the Debris

 

Vortex vigorously for 30-60 seconds and centrifuge at 10,000-20,000xg for 10 minutes to pellet the debris.

 

4. Pellet the DNA

 

Transfer the supernatant (~100 ul) to a 1.5-ml microfuge tube. Add 0.5 volume (~50 ul) of AquaPrecipi and 0.5 volume (~50 ul) of 95-100% of ethanol. Vortex for 30 seconds to mix the contents and centrifuge at 10,000-20,000xg for 5 minutes to pellet the DNA. Flip to discard the supernatant and fill the tube with 70% ethanol by shooting the ethanol solution at the cap of the tube from a squirt bottle, and then flip to discard the ethanol. Repeat the 70% ethanol rinse 3 times. Air-dry the DNA pellet. Add 50 ul of deionized water, pipette and vortex vigorously to suspend the DNA. Incubate at 22 °C for 15 min to solubilize the DNA and then centrifuge for 5 minutes to pellet any insoluble (optional: transfer the clear DNA solution to a new tube). Store the DNA solution at 4° or at –20° C for long-term storage.

 

Note: Due to the mechanism of AquaPrecipi to prevent salts and PCR inhibitors from binding to the DNA during purification, the purified DNA may appear smear in gel electrophoresis but it does not affect PCR amplification. If 10-20 mM of NaCl or other salts is added to the final DNA solution or the loading buffer the DNA will regain its normal gel migration pattern (see the gel photo below). Please also note that feces contain much more degraded cell-free DNA.

 

aquaprecipi_salt.jpg 

Left lane: AquaPrecipi purified stool DNA in 10 mM NaCl TE buffer.

Right lane: AquaPrecipi purified stool DNA in deionized water.

 

 

 

 


 

AquaGenomic Hair Protocol

 

This protocol uses 100 ul of AquaGenomic Solution to prepare 200-400 ng of DNA from 10 hair follicles.

 

1. Harvest the Cells

 

Pluck 10 individual hairs. Cut the hair follicles (the whitish portion near the base of the hair) off into a 1.5-ml microfuge tube. To prevent cross contamination. rinse the scissors with deionized running water, dip it in ethanol, and then flame it on a Bunsen burner, before use it to cut the hair follicles of the next subject.

 

2. Extract the DNA

 

Add 100 ul of AquaGenomic Solution to the sample. Briefly centrifuge to ensure all the hair follicles are submerged in the solution. Incubate at 60-65° C for 15 minutes.

 

3. Pellet the Debris

 

Vortex vigorously for 30-60 seconds and centrifuge at 12,000-20,000xg for 4 minutes to pellet the debris.

 

4. Pellet the DNA

 

Transfer the supernatant (~90 ul) to a fresh 0.5-ml microfuge tube. Add 1 volume of 100% isopropanol and mix by vortexing for 30 seconds. Centrifuge at 10,000-20,000xg for 2 minutes to pellet the DNA. Flip the tube to discard the supernatant. Fill the microfuge tube with 70% ethanol by shooting the ethanol solution at the cap of the tube from a squirt bottle, and then flip to discard the ethanol. Repeat the 70% ethanol rinse 3 times. Air-dry the DNA pellet. Add 50 ul of TE buffer or deionized water, pipette up-and-down and vortex vigorously to suspend the DNA. Incubate at 22 °C for 15 min to solubilize the DNA and then centrifuge for 2 minutes to pellet any insoluble (optional: transfer the clear DNA solution to a new tube).

 

 

 


AquaGenomic Drosophila Protocol

 

(Courtesy of Kelly Beumer at The University of Utah)

 

 

  1. Add 50 ul AquaGenomic solution to 1 fly in 1.5 ml microfuge tube.

  1. Homogenize with Kontes disposable pestle, either by hand or with the Kontes pellet pestle motor for 5-10 sec. Up to 48 preps at a time can be done. Leave the homogenized flies on the desk until all flies have been homogenized.
  1. Incubate at 60-65˚ C for 4 min (Note: Dr. Vett Lloyd of Mt. Allison University found that increasing the 60-65˚ C incubation to 45 min would inactivate any residual nucleases.).

  1. Vigorously vortex each tube 20-40 sec.

  1. Centrifuge sample at max speed (16000 rpm) for 4 min.

  1. Transfer supernatant to new tube containing 1 volume isopropanol. Mix.

  1. Centrifuge at max speed for 4 min; decant supernatant.

  1. Rinse with ~500 ul 70% ethanol by shooting the ethanol solution from a squeeze bottle just below the rim of the tube. Decant ethanol and pipet off remaining solution.

  1. Allow tubes to dry ~15 min at room temperature.

  1. Add 30 ul 10 mM Tris, TE, or ddH2O to DNA. Leave on bench overnight, vortex, or heat at 60˚ C for one hour to resuspend.

  1. Store at  either 4˚ or –20˚ C

0.5 ul of this solution is sufficient for a PCR reaction.

 

 


AquaRNA Protocols

 

 


 AquaRNA Total DNA/RNA/Protein Extraction Protocol 

 

This protocol may be used to extract up to 50 ug of DNA, 25 ug of RNA, and 1500 ug of proteins from 2.5 million mammalian cells or 25 mg animal tissue, using 500 ul of AquaRNA. You may scale up or down proportionately using different amount of starting materials. Vortex the AquaRNA solution to mix well before dispensing 

 

1. Lyse the Cells

 

For eukaryotic cells: Pellet ~2.5 million cultured cells by centrifugation at 12,000xg for 30 seconds. Aspirate to discard the medium, leave behind ~50 ul of medium and vortex to resuspend the cells. Transfer the cell suspension to 500 ul of AquaRNA preloaded in a 1.5-ml microfuge tube, vortex to mix well and invert the tube to wet the entire interior of the tube to ensure no RNase escape inactivation.

 

For microbial cells:  Centrifuge 2 ml log-phase bacterial culture at 12,000xg for 30 seconds to pellet the cells. Aspirate to discard the medium and suspend the cells in 500 ul of 1 mg/ml lysozyme (not supplied, use lyticase or equivalent for yeast cells) in TE buffer (pH 8.0, lysozyme will not be as effective at pH <8) and incubate on ice for >15 minutes, and vortex occasionally. Transfer the cell suspension to 500 ul of AquaRNA preloaded in a 1.5-ml microfuge tube, vortex (for best results, homogenize with ~100 ug of 100 um dia. glass beads or white sands using a bead beater) and invert the tube to wet the entire interior of the tube to ensure no RNase escape inactivation.

 

For animal tissues: Homogenize ~25 mg fresh or frozen or pulverized animal tissue in 500 ul of AquaRNA with a pestle-and-tube homogenizer, move the pestle up and down while vortexing at maximal speed to fully homogenize the tissue (or homogenize the tissue with a mix of sixty 1.4-mm and six 2.8-mm ceramic beads, if a bead beater is available).

 

For plant tissues: Homogenize ~50 mg fresh or frozen or pulverized plant tissue in 500 ul of AquaRNA with a pestle-and-tube homogenizer, move the pestle up and down while vortexing at maximal speed to fully homogenize the tissue (or homogenize the tissue with a mix of sixty 1.4-mm and six 2.8-mm ceramic beads, if a bead beater is available).

 

2. Extract the Proteins

 

Transfer 50 ul of the cell lysate or tissue homogenate (avoid transferring large tissue debris if any) to a 1.5-ml microfuge tube. Add 200 ul of deionized water to the homogenate, vortex for 30 sec, and then add 1 ml of acetone and vortex for 30 sec. Centrifuge at 12,000xg for 5 min to pellet the proteins. Decant to discard the supernatant, tap the tube on a clean paper towel to remove residual acetone. Immediately add 100 ul of ProMelt (Item # 1115, not included, which is a 1% SDS based protein solubilizing solution) to the protein pellet (do not dry the protein pellet), pipette and vortex to suspend the pellet, and then incubate at room temperature (or at 65 °C) for >15 min to fully solubilize the proteins. Centrifuge at 12,000xg for 5 min to pellet any insoluble, transfer the protein solution to a new tube and store at 4 or –20 °C (some SDS will precipitate out at these temperatures, you may centrifuge the sample at 12,000xg for 5 min at 4 °C to pellet the SDS precipitates prior to protein assay).

 

3. Extract the DNA and RNA

 

Incubate the cell lysate or tissue homogenate at room temperature for 15 minutes. Centrifuge the cell lysate or tissue homogenate at 12,000xg for 5 min to pellet the debris. Transfer the clear lysate (~400 ul) to a corresponding 1.5-ml microfuge tube. Add 1 vol (~400 ul) of isopropanol to the lysate (do not incubate the tube at –20 °C or on ice). Vortex and centrifuge at 12,000xg for 5 min to pellet the DNA and RNA. Decant to discard the supernatant. Fill the tube with 70% ethanol from a squirt bottle and then decant to discard the ethanol solution. Be sure to rinse the entire interior of the tube, including the inside of the cap. Repeat the ethanol rinse 2-3 times. Tap the tube on a paper towel to remove residual ethanol, leave the tube up side down on the paper towel for a few minutes to air dry the DNA/RNA pellet. Add 100 ul of nuclease-free water to the DNA/RNA pellet, vortex or pipette to wet the entire sidewall to solubilize the DNA/RNA pellet. Incubate at 22 °C for 15 min and then centrifuge at 12,000xg for 5 min to pellet any insoluble (optional: transfer the DNA/RNA solution to a new tube) and store at 4 or –20 °C. If DNA removal is desired, add 0.5 units of DNase I (not supplied) to 10-20 ul of DNA/RNA solution, incubate at 22-37 °C for 30 minutes. After the digestion, run a 0.7% non-denaturing agarose gel to see if DNA digestion is complete and the RNA bands remain intact. To inactivate the DNase I, use Ambion’s DNase removal reagent or heat-inactivate the DNase I at 70 °C for 15 min. 

 

 

western blot1.png

 

Western blotting of AquaRNA extracted proteins. Human uterus sarcoma MES-SA cells were cultured in a 6-well plate and the cells were lysed in the wells with 0.5 ml AquaRNA after removing the culture medium. Cellular DNA and RNA in the lysate were precipitated with 1 volume of isopropanol. Proteins remained in the isopropanol supernatant were subsequently precipitated with 4 volumes of acetone. The protein pellet was solubilized in 200 ul of 1% SDS and 7 ul of each protein sample (~600 ug/ml) were subjected to Western blotting using primary antibodies against b-tubulin, b-actin, and GAPDH respectively. The results indicate that AquaRNA is able to extract both structural and soluble proteins for Western analysis.

 

 

 


 

AquaRNA Viral Protocol

 

AquaRNA is suitable for extracting DNA, RNA, and proteins from double- or single-stranded DNA viruses and RNA viruses, including bacteriophages. The DNA, RNA, and protein yields may vary depending on the genome size of the virus and the viral titer of the starting material but are close to theoretical values. The starting volume of 50 ml used in this protocol is for demonstration only; you may use different starting volume. For example, you may process 1 ml of bacterial culture containing 109 phage virons with 50 ul of AquaRNA to recover ~2 ng DNA from phi X174 or ~120 ng DNA from T4 phages, sufficient for most PCR analyses.

 

 

1. Centrifuge virus infected culture (50 ml) at 12,000g for 5 min to pellet the cells.                                                                                

2. Transfer the virus containing supernatant to a new centrifuge tube (Optional: Add DNase and RNase to the supernatant and incubate at 37 °C for a few minutes if complete cellular DNA and RNA removal is needed).

                                                                                   

3. Add 1 volume of 20% PEG8000 in 2.5M NaCl to 5 volumes of virus supernatant (At 3% PEG, cellular DNA and RNA will not be pelleted with the virions and will be removed in next step).     

                                                                       

4. Vortex to mix and centrifuge at 12,000g for 10 min to pellet the virions. Decant or aspirate to remove the PEG supernatant as completely as possible.                                                                          

5. If the virus is to be saved as high titer stock, suspend the pellet in 100 ul of 10% glycerol in PBS and store at -20 °C. Otherwise, add 0.5 ml of AquaRNA solution to the pellet. Vortex vigorously and incubate on ice for 15 min to lyse the virions.

                                                                                   

6. Transfer the lysate to a 1.5-ml microfuge tube and add 1 volume of isopropanol to precipitate the viral DNA (or RNA). Vortex to mix well and centrifuge at 12,000g for 5 min to pellet the DNA (or RNA).

                                                                                   

7. If viral proteins are to be recovered, transfer the protein-containing supernatant to a new tube for protein precipitation later with 4 volumes of acetone. Otherwise, decant to discard the supernatant.

                                                                                   

8. Rinse the viral DNA (or RNA) pellet with 75% ethanol 3 times by filling the tube with the ethanol solution from a squirt bottle and then decanting to discard the solution. Air-dry the pellet and dissolve the DNA (or RNA) in 50 ul of water or TE buffer.

 

 

 

 


AquaRNA Blood Protocol

 

(We recommend AquaPreserve Blood Protocol for DNA, RNA, and protein extraction from blood specimens. It is much simpler and does not require the removal of red blood cells, therefore, minimizes white blood cell lysis and DNA, RNA, and protein loss during the red blood cell lysis step.)

 

This protocol may be used to extract 200-400 ng of DNA from a dried bloodspot (from ~10-20 ul wet blood) or other biological samples such as bone marrow, using 100 ul of AquaRNA.

 

1. Harvest the Cells

 

Add 100 ul of normal saline (0.9% NaCl) to the dried bloodspot on glass slide. Use the pipette tip to dislodge and transfer the sample to a 0.5-ml microfuge tube. (If the bloodstain is on other backing, scrap or cut it directly into a microfuge tube and add saline to extract the blood). Pipette and vortex to fully suspend the blood until no clump is visible. Centrifuge at 12,000-20,000xg for 2 minute to pellet the cells. Aspirate to remove the brown hemoglobin supernatant and leave behind the visible cell pellet.

 

2. Extract the DNA

 

Add 100 ul of AquaRNA Solution to the cell pellet. Vortex vigorously to lyse the cells and extract the DNA. Incubate at room temperature for 5 minutes and vortex again to ensure a homogeneous lysate with no visible insoluble.

 

3. Pellet the DNA

 

Add 1 volume (~100 ul) of 100% isopropanol to the lysate and mix the contents by vortexing for 30 seconds. Centrifuge at 12,000-20,000xg for 5 minutes to pellet the DNA. Decant to discard the supernatant. Fill the microfuge tube with 75% ethanol by shooting the ethanol solution from a squeeze bottle at the cap of the tube, and then decant to discard the ethanol. Repeat the 70% ethanol rinse 2-3 times. Flip the tube and tap it several times on a paper towel to remove residual ethanol. Add 20 ul of deionized water, incubate at room temperature for 15 min to fully rehydrate the pellet, pipette or vortex vigorously to suspend the DNA. Store the DNA solution at –20 or –80 °C.

 

 

 


 

  small rna1.png

 

AquaRNA Small RNA Protocol

 

This protocol can be used to isolate small RNAs, including 5S RNA, tRNA, microRNA, siRNA, or degraded RNA from various starting materials. It is essentially the same protocol as AquaRNA Cell, Tissue, Microbe, and Plant Protocols, except the addition of a 0.6 volume isopropanol (i.e., 40% final concentration) debris precipitation step to remove all other cellular components.

 

1. Extract the RNA

 

For bacteria: Vortex to mix 500 ul of AquaRNA with 500 ul of lysozyme-treated bacteria (from 2.5 ml culture) in a 1.5-ml microfuge tube. Invert the tube a few times to wet the entire interior of the tube and incubate on ice for 30 min.

 

For cell cultures: Vortex to mix 500 ul of AquaRNA with 50 ul cell suspension (~5 million cells) in a 1.5-ml microfuge tube. Invert the tube a few times to wet the entire interior of the tube and incubate on ice for 30 min.

 

For tissues: Homogenize 50 mg of tissue in 500 ul of AquaRNA on ice and incubate on ice for 30 min. Vortex occasionally. Transfer the homogenate to a 1.5-ml microfuge tube.

 

2. Pellet the Debris

 

Add 0.6 volume (Do not add more than 0.7 volume or you will lose some small RNA.) of 100% isopropanol to the above lysate (for example, add 300 ul isopropanol to 500 ul lysate). Vortex and invert the tube to mix well. Centrifuge at 12,000-20,000xg for 10 min to pellet DNA and large RNA. Transfer the small RNA containing supernatant to a new microfuge tube.

 

4. Pellet the Small RNA

 

Add 0.4 volume (with respect to the volume of the recovered small RNA containing supernatant from Step 2 above) of 100% isopropanol to the supernatant (for example, add 300 ul isopropanol to 750 ul recovered supernatant). Vortex to mix well. Centrifuge at 12,000-20,000xg for 10 minutes to pellet the small RNA. Flip to discard the supernatant. Fill the microfuge tube with 75% ethanol by shooting the ethanol solution from a squeeze bottle at the cap or sidewall of the tube, and then flip to discard the ethanol. Repeat the 75% ethanol rinse 2-3 times. Flip to discard residual ethanol as completely as possible. Air-dry the pellet for ~2-3 minutes. Add 100 ul of RNase-free water and vortex to solubilize the RNA. Store the RNA solution at -20 to -80 °C.

 

 

 

 


 

 Img42.png 
 
AquaRNA RNase Decontamination Protocol

 

AquaRNA may be used to inactivate and remove residual RNases in purified RNA. Most RNA purification methods cannot completely remove contaminating RNases from RNA samples. The purified RNA therefore may be degraded during storage or analysis. This is the reason that RNA is notoriously known as labile, unstable, and difficult to work with. To test if your RNA is contaminated with RNase, you could incubate an aliquot of the sample in 1x DNase I buffer (or any common molecular biology reaction buffer supplemented with 1 mM CaCl2) at 37 °C for 15 minutes, and then check the RNA integrity by gel electrophoresis. This RNase contamination test should be a routine prior to the start of any RNA experiment. If RNase contamination is detected, the RNA sample must be de-contaminated with AquaRNA. The protocol below may be used to inactivate RNases in 100 ul of RNA sample using 100 ul of AquaRNA. You may adjust the volume of AquaRNA for different sample volumes. (Note: This protocol may also be used to decontaminate RNases in plasmid DNA prior to its use in in vitro transcription reactions. It may also be used to decontaminate DNases in purified DNA samples, reduce protein contamination, and facilitate long-term storage of DNA samples at room temperatures.)

 

1. Add 100 ul of AquaRNA solution to 100 ul of RNA sample.

 

2. Vortex to mix well, invert the tube to wet the entire interior, and incubate the sample at room temperature for 15 minutes to inactivate RNases.

 

3. To recover the RNA, add 200 ul of 90-100% isopropanol to the sample. Vortex to mix well. Centrifuge at 12,000-20,000 xg for 5 minutes to pellet the RNA. Decant the tube to discard the supernatant.

 

4. To rinse the pellet, fill up the tube with 75% ethanol by gently shooting the ethanol solution from a squirt bottle at the cap of the tube without disturbing the pellet and decant to discard the ethanol solution. Repeat the ethanol rinse 2 times.

 

5. Air dry the pellet and resuspend the RNA in 100 ul of RNase-free water.

 

 

 

 


AquaBluer Cell Viability Assay Protocol

 

This protocol serves as an example to perform cytotoxicity assay using AquaBluer™ in a 96-well format. Use 10 ul of 1x AquaBluer™ for each 100 ul of sample (for 384-well and other formats, adjust the volumes accordingly). 

 

1. Set up 96-well culture plates

 

Seed the cells at 100 ul/well in 96-well culture plates (you may use either opaque-walled or regular clear-walled 96-well plates). Set up quadruplicate wells of 1) no-cell control (100 ul of medium, for background scattering subtraction), 2) vehicle control (100 ul of cells with the vehicle of test compound, as 100% viability), 3) positive control (optional, 100 ul of cells treated with a known cytotoxic compound), 4) test compound (100 ul of cells treated with 6-8 concentrations of 1:1 serially diluted test compound around its estimated IC50). Depending on the toxicity of the compound, incubate at 37 °C for 16-72 hours.

 

2. Add 1x AquaBluer™ to the samples

 

To prepare 1x AquaBluer™ working concentration, add 1 volume of the 10x concentrated AquaBluer™ to a reagent reservoir, add 9 volume of fresh culture medium, and pipette up-and-down 10 times to mix well. Remove the culture plates from the incubator and add 10 ul of 1x AquaBluer™ to each well with a multi-channel pipettor. Shake the plates briefly and return to the incubator for 1–4 hours (it is optimal to have ~1000 RFU for the vehicle control at the end of 4-hour AquaBluer™ incubation).

 

3. Data acquisition and calculation

 

Remove the plates from the incubator and allow them to equilibrate at room temperature in the dark for 30 min. Place the plate in a fluorescence plate reader and read the fluorescence intensity at 540ex/590em. Data calculation may be done as follows: 1) Subtract the average of fluorescence values (RFU) of the no-cell controls (background) from all other RFU values. 2) Convert the test RFU values to percent of inhibition using the formula: % of Inhibition = 100x(RFUveh – RFUtest)/RFUveh. 3) Enter the % of Inhibition values and corresponding test compound concentrations into a non-linear regression program such as Prism or online calculator such as BioDataFit at http://www.changbioscience.com/stat/ec50.html to obtain the IC50 values of your test compound and the dose-response curve.

 

(Note: If a fluorescence plate reader is unavailable, you may use an absorbance plate reader to acquire AquaBluer™ viability data by recording A570 and A600 for each well at the end of the AquaBluer™ incubation period, subtracting each A600 value from its corresponding A570 value, and then performing the three steps of data calculation above for fluorescence data to obtain the IC50.)

 

 

 

 


AquaStool Protocols

 

 

 


Streamlined Fecal Specimen Preservation, Preparation, and Analysis Protocols

 

These protocols describe the use of AquaStool to collect, stabilize, preserve, ship, and store fecal specimens, extract fecal DNA and RNA, and analyze the purified fecal DNA and RNA by PCR and RT-PCR.

 

Stool Collection and Preservation

 

AquaStool stabilizes and preserves DNA and RNA by inactivating degradative enzymes. Unlike cross-linking reagents (e.g., formalin) AquaStool preserves the specimen without damaging the DNA and RNA, and unlike high salt preservatives (e.g., Ambion’s RNAlater®) it irreversibly inactivates DNases and RNases and pathogens. This protocol describes the use of 10 ml of AquaStool solution to collect one gram of human feces. However, using 0.5 ml of AquaStool solution to collect 50 mg of feces is sufficient for most applications. In addition to preserving fecal specimens, AquaStool may also be used to preserve other biospecimens, such as microbes, culture cells, animal and plant tissues, and even insects, for DNA, RNA, and protein extractions. Because of AquaStool’s ability to lyse and inactivate bacteria, viruses, fungi, and parasites, it reduces the biohazards of biospecimens and improves biosafety to research workers.

 

1.      Transfer a level spoonful (~1 gram) of fresh stool into a 15-ml stool collection tube (SARSTEDT # 80.734.311) containing 10 ml of AquaStool solution, using the spoon attached to the cap of the stool collection tube.

 

2.      Stir and smash the stool with the spoon to facilitate the contact of the specimen with AquaStool solution. Securely screw-tight the cap and shake the content vigorously a few times.

 

3.      Bring or mail the stool specimen to the laboratory. (Note: AquaStool preserved sample is stable at room temperatures and should have no problem shipping in mild ambient temperatures. However, we have not studied if it is stable at extremely high temperatures, such as in an unventilated shipping container in a hot summer day, which may reach over 100 °C. Therefore, shipment in blue ice gel packs should be considered to ensure all specimens from different climate regions will be exposed to the same shipping temperatures.)

 

Stool Specimen Storage

 

Upon receiving the stool specimens in the laboratory, the samples can be stored at 4 °C for a week before processing or in a –20 or –70 °C freezer. However, for the convenience and streamlining of subsequent fecal DNA and RNA extractions, the sample is preferably divided into 0.5 ml aliquots, each containing ~50 mg of fecal materials, in 1.5-ml microfuge tubes as described below.

 

1.      Vortex the stool specimen in the stool collection tube vigorously at top speed to fully homogenize the specimen.

 

2.      Load ~100 ug of sands (Sigma # 274739, white, 50+70 mesh) into 1.5-ml microfuge tubes. The sands are required for bacterial cell lysis and DNA/RNA extraction. It is convenient to use the cap of a 0.2-ml PCR tube to scoop and add the sands into the 1.5-ml tubes and one capful of sands is ~90-100 ug.

 

3.      Transfer 0.5 ml of the homogenized stool specimen into the 1.5-ml microfuge tubes pre-loaded with sands. Use a 1-ml blue pipet tip with its very tip been cut off for specimen transferring so it would not be clogged by fecal debris.

 

4.      Label the tubes and store the samples at –20 or –70 °C for long-term storage.


Fecal DNA Extraction

  

1.      Extract the DNA: Retrieve 0.5 ml stool specimen in a 1.5-ml microfuge tube pre-loaded with 100 ug of sands from storage. Vortex the tube up side down at top speed for at least 60 s (i.e., bead beating). Incubate at 65 °C for 15 min (may incubate at 22 °C with slightly lower DNA yield). Vortex again for 60 s after the incubation and centrifuge at 14000 xg for 5 min to pellet the debris.

 

2.      Precipitate the DNA: Transfer 0.4 ml of cleared lysate to a 1.5-ml tube pre-loaded with 0.4 ml of isopropanol. Vortex for 10 s to mix. Centrifuge at 14000 xg for 5 min to pellet the DNA. Decant to discard the supernatant. Rinse the pellet by filling-up the tube with 70% ethanol using a squirt bottle (be sure to rinse the entire interior of the tube, including the cap and the mouth of the tube), and decant to discard the ethanol solution. Repeat the ethanol rinse 3-4 times. Tap the tube on a clean paper towel to remove residual ethanol and air-dry the pellet for 1-2 min.

 

3.      Solubilize the DNA: Add 0.4 ml nuclease-free water to the pellet, pipet to dislodge the pellet, and then vortex at top speed to fully disperse the pellet. Incubate at 22 °C for 15 min and then centrifuge at 12,000xg for 5 min to pellet any insoluble (optional: transfer the DNA supernatant to a new tube). The concentration of the DNA solution may be estimated by diluting 2 ul of the sample with 98 ul of TE buffer (pH 8) for OD260 and OD280 reading and then calculating the concentration using the formula of DNA concentration (ng/ul) = 50 (dilution factor) x 50 (ng/ul) x OD260. The expected DNA concentration should be around 200 ng/ul and the total DNA yield from 0.5 ml of AquaStool preserved stool specimen (~50 mg of feces) should be about 80-100 ug, which is 5-10 times higher than the DNA yield obtained with other fecal DNA extraction kits. Store the DNA solution at 4 or –20 °C.                                                                          


Fecal RNA Extraction

 

1.      Extract the RNA: Retrieve 0.5 ml stool specimen in a 1.5-ml microfuge tube pre-loaded with 100 ug of sands from storage. Vortex the tube up side down at top speed for at least 60 s (i.e., bead beating). Place the tube on a foam floater and immerse the tube in the water bath of a bath sonicator (Branson Ultrasonic Cleaner 2510, 40kHz, Danbury, CT). (Note: It is critical to position the tube right on top of the head of the ultrasonic generator, as the ultrasonic strength decreases from the head of generator. Consult your user manual to identify the location of the generator head or do a test extraction to identify the position that produces the best RNA yield. For Branson 2510, the two generator heads are positioned just outside of the left and right sides of the OPERATING LEVEL mark in the middle of the tank). Sonicate for 30 min at 22 °C (Note: You may place the sonicator in a ventilation hood with its door closed to reduce the noise during operation). Vortex again for 60 s after the sonication and centrifuge at 14000 xg for 5 min to pellet the debris.

 

2.      Precipitate the RNA: Transfer 0.4 ml of cleared lysate to a 1.5-ml tube pre-loaded with 0.4 ml of isopropanol. Vortex for 10 s to mix. Centrifuge at 14000 xg for 5 min to pellet the RNA (DNA are sheared by sonication in the presence of sands, Fig. 1). Decant to discard the supernatant. Rinse the pellet by filling-up the tube with 70% ethanol using a squirt bottle (be sure to rinse the entire interior of the tube, including the cap and the mouth of the tube), and decant to discard the ethanol solution. Repeat the ethanol rinse 3-4 times. Tap the tube on a clean paper towel to remove residual ethanol and air-dry the pellet for 1-2 min.

 

3.      Solubilize the RNA: Add 0.4 ml nuclease-free water to the pellet, pipet to dislodge the pellet, and then vortex at top speed to fully disperse the pellet. Incubate at 22 °C for 15 min and then centrifuge at 14000 xg for 5 min to pellet the insoluble (optional: transfer the RNA supernatant to a new tube). The concentration of the RNA/DNA solution may be estimated by diluting 2 ul of the sample with 98 ul of TE buffer (pH 8) for OD260 and OD280 reading and then calculating the concentration using the formula of RNA/DNA concentration (ng/ul) = 50 (dilution factor) x 45 (ng/ul) x OD260. The expected RNA/DNA concentration should be around 450 ng/ul and the total RNA/DNA yield from 0.5 ml of AquaStool preserved stool specimen (~50 mg of feces) should be about 150-200 ug, of which about 1/2 – 1/3 is RNA. Store the RNA solution at –20 or –70 °C.


PCR and RT-PCR Amplification

 

The most common application of fecal DNA and RNA is to determine if specific DNA or RNA sequences exist in the fecal specimen by PCR genotyping or RT-PCR RNAtyping for the diagnosis of cancers, bacterial, viral, fugal, and parasitic infections; identification of transgenic animals; analysis of human and animal intestinal microbiome; and survey of wildlife animals. However, most fecal DNA and RNA extraction methods are unreliable and often have a PCR failure rate ranging from 20-100%, due to their poor and inefficient DNA/RNA protection, extraction, and PCR inhibitor removal. AquaStool purified fecal DNA and RNA are suitable for various downstream applications. The PCR and RT-PCR protocols provided here may be adjusted for your specific application.

 

1.      DNase I digestion. AquaStool extracted fecal RNA contains large amount of sheared DNA. RT-PCR can be performed without removing the contaminating DNA, if appropriate primer pair is designed to avoid the amplification of genomic DNA sequence or produce different amplicon size. Otherwise, DNase I treatment is required prior to reverse transcription. To digest the DNA, 40 ul of the 400 ul of AquaStool purified RNA is incubated with 0.5 ul of DNase I in its 1x buffer at 22 °C for 40-60 min (Note: Almost all commercial DNase I products have RNase activity. Using minimal amount of DNase I and incubating at room temperature for extended period helps reduce RNA loss. Even if the DNA digestion is incomplete and there are still a lot of < 250 bp fragments, they would not likely affect your PCR or RT-PCR). Following DNase digestion, the DNase is removed with 4 ul of DNase Inactivation Reagent (Ambion # AM1906).

 

 

                                         dnase digest of frna.jpg

 

Figure 1. AquaStool purified fecal DNA and RNA.  Aliquots (5 ul) of the extracted DNA (Lane 2), RNA (Lane 3), and DNase I treated RNA (Lane 4) were run in a 0.8% agarose gel. As shown, AquaStool extracts intact fecal DNA and RNA. It recovers not only large RNAs but also small RNAs, including 5S rRNA, tRNA, and microRNA.

 

 

2.      Reverse transcription. Anneal RT primer to its complimentary RNA by incubating 2 ul of 5 uM RT primer with 4 ul of DNase I treated RNA and 12 ul of nuclease-free water at 80 °C for 4 min and then on ice. Following primer annealing, add 2 ul of 10x buffer (you may use PCR reaction buffer), 0.2 ul of 25 mM dNTPs, and 0.5 ul of 100 U/ul MMLV Reverse Transcriptase to the mix and incubate at 42 °C for 60 min to synthesize the cDNA. Heat-inactivate the MMLV Reverse Transcriptase by incubating at 94°C for 10 min.

 

3.      PCR amplification. Assemble a 30 ul PCR reaction by mixing 3 ul of 10x PCR reaction buffer (with 2.5 mM MgCl2), 0.3 ul of 25 mM dNTPs, 2 ul of 5 uM PCR primer pair, 25 ul of nuclease-free water, 0.3 ul of DNA polymerase, and 2.5 ul of the above RT reaction (for RT-PCR) or 0.5 ul of ~200 ng/ul AquaStool purified DNA (for PCR). Run 30 cycles of PCR reaction.

 

                                            Img55.jpg

 

Figure 2. PCR and RT-PCR amplification of fecal DNA and RNA. Human fecal DNA and RNA were extracted with AquaStool. Bacterial, plant (food), and host DNA and RNA in the fecal specimens were analyzed by 30 cycles of PCR and RT-PCR. Lane 1 and 12 are 100 bp DNA ladder; Lane 2 is no DNA/RNA negative control; Lane 3 (PCR), 4 (no RT control), and 5 (RT-PCR) were amplified with a bacterial primer pair (forward primer AGAGTTTGATCCTGGCTCAG and reverse primer GGTTACCTTGTTACGACTT); Lane 6 (PCR), 7 (no RT control), and 8 (RT-PCR) were amplified with a plant primer pair (forward primer GCGTGGACCTGGAATGACTA and reverse primer AGGTTGTATTAAAGTTTCGATCG); Lane 9 (PCR), 10 (no RT control), and 11 (RT-PCR) were amplified with a human primer pair (forward primer TTCCGCAAGTTCACCTACC) and reverse primer CGGGCCGGCCATGCTTTACG). Arrows point at RT-PCR products. The data indicate that it is possible to extract both fecal DNA/RNA with AquaStool for genotyping and RNAtyping of bacterial, food, and host DNA and RNA biomarkers from a single fecal specimen.

 

 

 


 

Mouse Fecal DNA/RNA Extraction for Genotyping and RNAtyping

 

AquaStoolÔ may be used as a non-invasive method for concurrent extraction of DNA and RNA from a single mouse fecal dropping for genotyping (determination of the genetic status) and RNAtyping (determination of the RNA expression status). It may be used to identify and characterize transgenic animals not only carry but also express the intended genetic modifications. Furthermore, unlike tail/toe/ear snipping, fecal sampling is not limited by animal age, physiopathological condition, and sampling frequency. This non-invasive concurrent genotyping and RNAtyping method can enhance animal welfare and benefit the transgenic research community.

 

1. Fecal sample collection: Transfer a mouse to a clean cage (5-10 cages at a time) covered with a clean diaper or a sheet of paper towel. Fecal pellets usually appear in a few minutes. Label each 0.5-ml microfuge tube with corresponding mouse ID. Scoop up a fecal pellet with the microfuge tube or its cap (Important: double check the mouse ID and tube ID to avoid mislabeling the fecal pellet). Put the mice back to their original cage. Replace the diaper in each collection cage and start another round of collection.  

 

2. Fecal DNA/RNA extraction: Add ~30 ug (1/2 a scoop in the cap of a 0.2 ml PCR tube) of white sands (Sigma # 274739, white, 50-70 mesh) and 200 ul of AquaStool to each fecal pellet. Let the pellet soak in AquaStool solution for 15-30 min and then vortex with the tube up side down at top speed for 1-2 min to fully homogenize the fecal material. Centrifuge at 14,000xg for 5 min to pellet the debris. Transfer the supernatant (~100 ul) to a 0.5-ml microfuge tube and add 100 ul of isopropanol. Vortex for 10 seconds to mix well and centrifuge at 14,000xg for 5 min to pellet the DNA/RNA. Flip the tube to discard the supernatant and fill the tube with 70% ethanol by shooting the ethanol solution at the cap of the tube from a squirt bottle, and then flip to discard the ethanol. Repeat the 70% ethanol rinse 2-3 times. Tap the tube on a clean paper towel to remove residual ethanol and air-dry the DNA/RNA pellet for 1-2 min. Add 100 ul of nuclease-free water, vortex vigorously (if needed, pipet to dislodge the DNA/RNA pellet) to fully suspend the pellet. Incubate at 22 °C for 15 min to solubilize the DNA/RNA and then centrifuge at 14,000xg for 5 minutes to pellet the insoluble (optional: transfer the clear DNA/RNA solution to a new tube). Quantitate the fecal DNA/RNA with a UV spectrophotometer and inspect it by agarose gel electrophoresis.

 

3. PCR genotyping: Set up a 30 ul PCR reaction using 0.5-1 ul of the fecal DNA/RNA and respective primer pair. After a 35 cycles of PCR amplification, separate the PCR products by agarose gel electrophoresis. Save the digital gel image and record the positive or negative PCR amplification result for each fecal sample.

 

4. RT-PCR RNAtyping: Digest the DNA in the fecal DNA/RNA prep by incubating 20 ul of the DNA/RNA with 0.3 ul of Ambion’s Turbo DNase I at 22 °C for 40 min and then inactivate the DNase I with 2 ul of Ambion’s DNase I Removal Reagent. Use 4 ul of the DNase I treated fecal RNA in a 20 ul cDNA synthesis reaction with MMLV Reverse Transcriptase. Subsequently use 3 ul of the cDNA in a 30 ul PCR reaction. After a 35 cycles of PCR amplification, separate the RT-PCR products by agarose gel electrophoresis. Save the digital gel image and record the positive or negative RT-PCR amplification result for each fecal sample.

 

 

          Img49.jpg

Figure 1. Concurrent extraction of fecal DNA and RNA from a single mouse fecal pellet. Mouse fecal DNA/RNA were extracted from a single fecal pellet with AquaStool. 20 ul of the 100 ul fecal DNA/RNA prep was treated with 0.3 ul of Ambion’s Turbo DNase at 22 °C for 40 min. 5 ul of the DNase I digested sample (Lane 3) and 5 ul of the undigested fecal DNA/RNA (Lane 2) were separated in a 0.8% agarose gel electrophoresis. As shown in the gel image, fecal DNA and RNA can be extracted from a single mouse fecal pellet with AquaStool. UV spectrophotometry analysis indicated that the A260/A280 ratio of the extracted fecal DNA/RNA was 1.8 and the DNA/RNA yield was 25 ug/pellet.

 

pcr and rt-pcr of mouse fdna-rna.jpg

Lane 1, 10: 100 bp DNA ladder.

Lane 2, 6: No DNA/RNA control.

Lane 3, 7: PCR amplification.

Lane 4, 8: Minus RT control.

Lane 5, 9: RT-PCR amplification.
Figure 2. PCR and RT-PCR amplification of AquaStool extracted mouse fecal DNA and RNA. Mouse fecal pellets were collected freshly or stored at room temperatures for 7 days. The AquaStool extracted fecal DNA/RNA were either amplified by PCR (Lane 3 and 7) or by RT-PCR (Lane 5 and 9). PCR amplification was conducted using the primer pair of Rig-S15f (5'-TTCCGCAAGTTCACCTACC) and Rig-S15r (5'-CGGGCCGGCCATGCTTTACG).  The results indicate that mouse feces can be stored at room temperatures up to 7 days without affecting DNA genotyping, however, for RNAtyping the fecal specimens need to be stored at –20 to –70 °C or preserved in AquaStool solution.

 

 


 

DNA/RNA Extraction from RNAlater Preserved Fecal Specimen

 

RNAlater® (Ambion) is a widely used preservative for stabilizing biospecimens prior to their DNA and RNA extraction. AquaStool may be used to extract DNA and RNA from RNAlater preserved fecal specimens similar to standard AquaStool protocols, except two important steps. First, prior to extraction, RNAlater should be removed from the specimen as completely as possible. Secondly, DNA and RNA in the cleared lysate should be precipitated with 0.7 volume, instead of the standard 1 volume, of isopropanol. These steps will prevent the highly concentrated salts in RNAlater from interfering DNA and RNA precipitation in isopropanol solution. However, you should note that this protocol is not suitable, if your target is cell-free DNA fragments or viruses in the feces as they will be discarded with RNAlater.

 

1. Centrifuge RNAlater preserved specimen at 14,000xg for 5 min to pellet the fecal materials.

                                                                       

2. Aspirate to remove RNAlater from the specimen as completely as possible.

                                                                                   

3. Add 90-100 ug of white sands and 0.5 ml AquaStool solution to the fecal pellet (~50 mg) in a 1.5-ml microfuge tube. Vortex the tube up side down at top speed for at least 60 s (beadbeating) to fully homogenize the specimen.

                                                                       

4. Incubate tube at 65 °C for 15 min (for fecal DNA extraction) or sonicate at 22 °C for 30 min (for fecal RNA extraction). At the end of the incubation or sonication, vortex again at top speed for 60 s.    

                                                                       

5. Centrifuge at 14,000xg for 5 min to pellet the fecal debris and transfer 0.4 ml clear lysate to a new tube. Add 0.7 vol (i.e., 0.28 ml) of isopropanol to the lysate.

                                                                                   

6. Vortex vigorously for 10 s to mix well and centrifuge at 14,000xg for 5 min to pellet the DNA or RNA (Note: If there are too much RNAlater carryover, you may see two phases and a thin DNA/RNA interphase. In that case, remove the top layer and add 1 ml of 70% ethanol to reprecipitate the DNA or RNA).

 

7. Rinse the DNA or RNA pellet with 70% ethanol 3-4 times by filling up the tube with the ethanol solution from a squirt bottle and then decanting to discard the ethanol solution. Tap the tube on a piece of clean paper towel to remove residual ethanol and air-dry the pellet for 1-2 min.

 

8. Add 200 ul of nuclease-free water to the DNA or RNA pellet. Pipet to dislodge the pellet and vortex vigorously to fully suspend the pellet. Incubate on ice for 10 min and then centrifuge at 14000xg for 5min to pellet the insoluble. Transfer the clear DNA or RNA solution to a new tube and store at –20 to – 70 °C.

 

 

 


 

AquaPreserve Protocols

 

 

 

 

 

 


 

AquaPreserve Blood Protocol

 

This protocol uses 0.4 ml AquaPreserve (vortex to mix well before use) to extract DNA, RNA, and proteins from 0.2 ml whole blood. However, you may scale up or down the starting volumes of blood specimen and AquaPreserve proportionately (1 vol of blood to 2 vol of AquaPreserve) as needed. Please note that EDTA is the preferred anticoagulant for blood collection for extracting DNA and RNA from whole blood with AquaPreserve.

 

1. Sample collection and storage. Collect blood in EDTA vacutainers. Aliquot 0.2 ml blood into 1.5 ml microfuge tubes (with screw-cap for shipping). Choose one of the following three options for further processing:

 

1)     Store the blood samples at –80 °C until extraction.

2)     Add 0.4 ml AquaPreserve to each tube, vortex or shake the tube to mix well, and then store at –80 °C until extraction.

3)     Add 0.4 ml AquaPreserve to each tube, vortex or shake the tube to mix well and incubate at 22 °C for 1 hr, and then add 0.2 ml ProSink (if protein extraction is desired, take out 50 ul of sample for protein extraction before adding ProSink), mix well, store and ship the specimens at ambient temperatures within 1-7 days. Upon arrival, store at –80 °C until extraction.

 

At the time of extraction, add 0.4 ml AquaPreserve to each frozen blood sample that has not been treated with AquaPreserve and vortex to thaw the blood samples (Important: Do not thaw the frozen blood without mixing with AquaPreserve or the RNA will be degraded). Incubate the AquaPreserve lysed blood at 22 °C for 1 hr.

 

2. Protein extraction. Vortex the AquaPreserve lysed blood, transfer 50 ul to a 1.5-ml microfuge tube, add 200 ul of deionized water, vortex for 30 sec, and then add 1 ml of acetone and vortex for 30 sec. Centrifuge at 12,000xg for 5 min to pellet the proteins. Decant to discard the supernatant, tap the tube on a clean paper towel to remove residual acetone. Immediately add 200 ul of ProMelt to the wet protein pellet, pipette and vortex to suspend the pellet, and then incubate at room temperature (or at 65 °C) for >15 min to fully solubilize the proteins. Centrifuge at 12,000xg for 5 min to pellet any insoluble, transfer the protein solution to a new tube and store at 4 or –20 °C (some SDS in ProMelt will precipitate out, you may centrifuge the sample at 12,000xg for 5 min at 4 °C to pellet the SDS precipitates prior to protein assay).

 

3. DNA/RNA extraction. Add 1/3 vol (~0.2 ml) of ProSink to 1 vol (~0.6 ml) of AquaPreserve lysed blood. Vortex vigorously for 30 sec. Centrifuge at 12000xg for 5 min to pellet the proteins. Transfer ~0.6 ml of clear lysate to a 1.5-ml microfuge tube and add 1 vol (~0.6 ml) of isopropanol to the lysate (do not incubate the tube at –20 °C or on ice). Vortex and centrifuge at 12,000xg for 5-10 min to pellet the DNA and RNA. Decant to discard the supernatant. Gently fill the tube with 70% ethanol from a squirt bottle and then decant to discard the ethanol solution. Be sure to rinse the entire interior of the tube, including the inside of the cap. Repeat the ethanol rinse 2-3 times. Tap the tube on a paper towel to remove residual ethanol, leave the tube up side down on the paper towel for a few minutes to air dry the DNA/RNA pellet (a thin layer on the wall of the tube, may not be visible). Add 50 ul of nuclease-free water, vortex or pipette to wet the sidewall to solubilize the DNA/RNA pellet. Incubate at 22 °C for 15 min and then centrifuge for 5 min to pellet the insoluble (optional: transfer the DNA/RNA solution to a new tube).

 

 

hit counter joomla

 

 

 

 

 

 

 


Copyright © 2010 MultiTarget Pharmaceuticals, LLC - All rights reserved