For microbial cells:  (1) Centrifuge 2.5 ml log-phase bacterial culture at 12,000-20,000xg for 30 seconds to pellet the cells. (2) Aspirate to discard the medium and suspend the cells in 500 ul of 1 mg/ml lysozyme (not supplied, use lyticase or equivalent for yeast cells) in TE buffer (pH 8.0, lysozyme will not be as effective at pH <8) and incubate on ice for >15 minutes, and vortex occasionally. (3) Transfer the cell suspension to 500 ul of AquaRNA preloaded in a 1.5-ml microfuge tube, vortex to mix well and invert the tube to wet the entire interior of the tube to ensure no RNase escape inactivation. (4) Incubate on ice for 15 minutes, vortex vigorously for a minute at the end of the incubation. (5) Centrifuge at 12,000-20,000xg for 5 min to pellet the cell debris and transfer the cleared lysate to a new microfuge tube.

For animal tissues: (1) Homogenize 50 mg fresh or frozen or pulverized animal tissue in 500 ul of AquaRNA. (2) Transfer the homogenate to a 1.5-ml microfuge tube and centrifuge at 12,000-20,000xg for 2 minutes to pellet the debris. (3) Transfer the lysate (~450 ul) to a new tube and incubate on ice for 15 minutes, vortex vigorously for a minute at the end of the incubation. (4) Centrifuge at 12,000-20,000xg for 5 min to pellet the cell debris and transfer the cleared lysate to a new microfuge tube.

For plant tissues: (1) Homogenize 50 mg fresh or frozen or pulverized plant tissue in 500 ul of AquaRNA. (2) Transfer the homogenate to a 1.5-ml microfuge tube and centrifuge at 12,000-20,000xg for 5 minutes to pellet the debris. (3) Transfer the clear lysate (~400 ul) to a new tube and incubate on ice for 15 minutes, vortex vigorously for a minute at the end of the incubation. (4) Centrifuge at 12,000-20,000xg for 5 min to pellet the cell debris and transfer the cleared lysate to a new microfuge tube.

2. Precipitate DNA/RNA

(1) Add 1 volume of 100% isopropanol to the lysate, vortex to mix well, centrifuge at 12,000-20,000xg for 5 minutes to pellet the DNA/RNA. (2) Transfer the supernatant to a new tube if protein recovery is desired and proceed as Step 3 Precipitate Proteins below. Otherwise flip the tube to discard the protein-containing supernatant. (3) Fill the tube with 75% ethanol by shooting the ethanol solution from a squirt bottle at the cap or sidewall of the tube, and then flip to discard the ethanol. Repeat the 75% ethanol rinse 3 times. (4) Flip to discard residual ethanol as completely as possible. Air-dry the pellet for a few minutes. (5) Add 100 ul of RNase-free water to the pellet and incubate at room temperature for 60 minutes to rehydrate the DNA/RNA. (6) Pipette up-and-down to break up the pellet and centrifuge at 12,000-20,000xg for 5 minutes to pellet any insoluble. Transfer the DNA/RNA solution to a new tube and store at –20 or -80 °C.

The purified DNA may be used for restriction digest, cloning, PCR, Southern blotting, chromosomal microarray, and ChIP-on-chip, etc. RNA contamination generally does not interfere with DNA analyses.

The purified RNA may be used for cDNA synthesis, RT-PCR, microarray, and Northern blotting, etc. with or without DNA removal. If DNA removal is desired, add DNase I buffer and 0.2 unit RNase-free DNase I (not supplied) to 20 ul of RNA solution, incubate at 22 °C for 30-40 minutes. To remove DNase, we recommend Ambion’s DNase removal reagent or you may precipitate the RNA with 1 volume of isopropanol, and heat-inactivate residual DNase I at 70 °C for 10 min. However, DNA removal is unnecessary if you design and use a 5’ tailed RT primer to make the cDNA and then use a pair of PCR primers, with one of them complementary to the unique tailed region of the RT primer to amplify the cDNA [Knuchel and Ansari. Tailed RT-PCR for the quantitation of chloramphenicol acetyl transferase (CAT) mRNA, In "Methods in Molecular Medicine, Vol.XX - Quantitative PCR Protocols," Humana Press, (Chapter 18):1-11, 1997; Hurteau and Spivack. mRNA-specific reverse transcription-polymerase chain reaction from human tissue extracts. Anal Biochem. 2002 Aug 15;307(2):304-15; and Chen, et al. Real-time quantification of microRNAs by stem–loop RT–PCR. Nucleic Acids Research 2005 33(20):e179 (FREE Full Text and Supplementary Data for primer design)].

3. Precipitate Proteins

(1) Transfer the protein-containing supernatant to a new tube following the isopropanol precipitation of DNA/RNA. (2) Add 4 volumes of acetone to the protein-containing supernatant and vortex to mix well. (3) Centrifuge at 12,000x for 5 min to pellet the proteins. (4) Flip the tube to discard the acetone supernatant into a waste container in a chemical hood. (5) Add 500 ul of 1% SDS to the pellet, pipette and vortex to fully suspend the pellet. (6) Centrifuge at 12,000xg for 5 min to pellet the insoluble AquaRNA components, and transfer the protein solution to a new tube and store at 4 to -80 °C. The purified proteins are ready for 1D-PAGE, 2D-PAGE, Western blotting and dot blotting.

Protein concentration may be estimated using the formula of Protein (mg/ml) = (1.55 x A280) - (0.76 x A260) after blanking the spectrophotometer with 1% SDS solution.

Western blotting of AquaRNA extracted proteins. Human uterus sarcoma MES-SA cells were cultured in a 6-well plate and the cells were lysed in the wells with 0.5 ml AquaRNA after removing the culture medium. Cellular DNA and RNA in the lysate were precipitated with 1 volume of isopropanol. Proteins remained in the isopropanol supernatant were subsequently precipitated with 4 volumes of acetone. The protein pellet was solubilized in 200 ul of 1% SDS and 7 ul of each protein sample (~600 ug/ml) were subjected to Western blotting using primary antibodies against b-tubulin, b-actin, and GAPDH respectively. The results indicate that AquaRNA is able to extract both structural and soluble proteins for Western analysis.

8. Rinse the viral DNA (or RNA) pellet with 75% ethanol 3 times by filling the tube with the ethanol solution from a squirt bottle and then decanting to discard the solution. Air-dry the pellet and dissolve the DNA (or RNA) in 50 ul of water or TE buffer.

Streamlined Fecal Specimen Preservation, Preparation, and Analysis Protocols

These protocols describe the use of AquaStool to collect, stabilize, preserve, ship, and store fecal specimens, extract fecal DNA and RNA, and analyze the purified fecal DNA and RNA by PCR and RT-PCR.

Stool Collection and Preservation

AquaStool stabilizes and preserves DNA and RNA by inactivating degradative enzymes. Unlike cross-linking reagents (e.g., formalin) AquaStool preserves the specimen without damaging the DNA and RNA, and unlike high salt preservatives (e.g., Ambion’s RNAlater®) it irreversibly inactivates DNases and RNases and pathogens. This protocol describes the use of 10 ml of AquaStool solution to collect one gram of human feces. However, using 0.5 ml of AquaStool solution to collect 50 mg of feces is sufficient for most applications. In addition to preserving fecal specimens, AquaStool may also be used to preserve other biospecimens, such as microbes, culture cells, animal and plant tissues, and even insects, for DNA, RNA, and protein extractions. Because of AquaStool’s ability to lyse and inactivate bacteria, viruses, fungi, and parasites, it reduces the biohazards of biospecimens and improves biosafety to research workers.

1.      Transfer a level spoonful (~1 gram) of fresh stool into a 15-ml stool collection tube (SARSTEDT # 80.734.311) containing 10 ml of AquaStool solution, using the spoon attached to the cap of the stool collection tube.

2.      Stir and smash the stool with the spoon to facilitate the contact of the specimen with AquaStool solution. Securely screw-tight the cap and shake the content vigorously a few times.

3.      Bring or mail the stool specimen to the laboratory. (Note: AquaStool preserved sample is stable at room temperatures and should have no problem shipping in mild ambient temperatures. However, we have not studied if it is stable at extremely high temperatures, such as in an unventilated shipping container in a hot summer day, which may reach over 100 °C. Therefore, shipment in blue ice gel packs should be considered to ensure all specimens from different climate regions will be exposed to the same shipping temperatures.)

Stool Specimen Storage

Upon receiving the stool specimens in the laboratory, the samples can be stored at 4 °C for a week before processing or in a –20 or –70 °C freezer. However, for the convenience and streamlining of subsequent fecal DNA and RNA extractions, the sample is preferably divided into 0.5 ml aliquots, each containing ~50 mg of fecal materials, in 1.5-ml microfuge tubes as described below.

1.      Vortex the stool specimen in the stool collection tube vigorously at top speed to fully homogenize the specimen.

2.      Load ~100 ug of sands (Sigma # 274739, white, 50+70 mesh) into 1.5-ml microfuge tubes. The sands are required for bacterial cell lysis and DNA/RNA extraction. It is convenient to use the cap of a 0.2-ml PCR tube to scoop and add the sands into the 1.5-ml tubes and one capful of sands is ~90-100 ug.

3.      Transfer 0.5 ml of the homogenized stool specimen into the 1.5-ml microfuge tubes pre-loaded with sands. Use a 1-ml blue pipet tip with its very tip been cut off for specimen transferring so it would not be clogged by fecal debris.

4.      Label the tubes and store the samples at –20 or –70 °C for long-term storage.

Fecal DNA Extraction

1.      Extract the DNA: Retrieve 0.5 ml stool specimen in a 1.5-ml microfuge tube pre-loaded with 100 ug of sands from storage. Vortex the tube up side down at top speed for at least 60 s (i.e., bead beating). Incubate at 65 °C for 15 min (may incubate at 22 °C with slightly lower DNA yield). Vortex again for 60 s after the incubation and centrifuge at 14000 xg for 5 min to pellet the debris.

2.      Precipitate the DNA: Transfer 0.4 ml of cleared lysate to a 1.5-ml tube pre-loaded with 0.4 ml of isopropanol. Vortex for 10 s to mix. Centrifuge at 14000 xg for 5 min to pellet the DNA. Decant to discard the supernatant. Rinse the pellet by filling-up the tube with 70% ethanol using a squirt bottle (be sure to rinse the entire interior of the tube, including the cap and the mouth of the tube), and decant to discard the ethanol solution. Repeat the ethanol rinse 3-4 times. Tap the tube on a clean paper towel to remove residual ethanol and air-dry the pellet for 1-2 min.

3.      Solubilize the DNA: Add 0.4 ml nuclease-free water to the pellet, pipet to dislodge the pellet, and then vortex at top speed to fully disperse the pellet. Incubate on ice for 10 min to release the DNA. Centrifuge at 14000 xg for 5 min to pellet the insoluble. Transfer the DNA supernatant to a new 1.5-ml microfuge tube (the DNA solution may appear light yellowish, but it no longer contains PCR inhibitors). The concentration of the DNA solution may be estimated by diluting 2 ul of the sample with 98 ul of TE buffer (pH 8) for OD260 and OD280 reading and then calculating the concentration using the formula of DNA concentration (ng/ul) = 50 (dilution factor) x 50 (ng/ul) x OD260. The expected DNA concentration should be around 200 ng/ul and the total DNA yield from 0.5 ml of AquaStool preserved stool specimen (~50 mg of feces) should be about 80-100 ug, which is 5-10 times higher than the DNA yield obtained with other fecal DNA extraction kits. Store the DNA solution at 4 or –20 °C.                                                                          

Fecal RNA Extraction

1.      Extract the RNA: Retrieve 0.5 ml stool specimen in a 1.5-ml microfuge tube pre-loaded with 100 ug of sands from storage. Vortex the tube up side down at top speed for at least 60 s (i.e., bead beating). Place the tube on a foam floater and immerse the tube in the water bath of a bath sonicator (Branson Ultrasonic Cleaner 2510, 40kHz, Danbury, CT). (Note: It is critical to position the tube right on top of the head of the ultrasonic generator, as the ultrasonic strength decreases from the head of generator. Consult your user manual to identify the location of the generator head or do a test extraction to identify the position that produces the best RNA yield. For Branson 2510, the two generator heads are positioned just outside of the left and right sides of the OPERATING LEVEL mark in the middle of the tank). Sonicate for 30 min at 22 °C (Note: You may place the sonicator in a ventilation hood with its door closed to reduce the noise during operation). Vortex again for 60 s after the sonication and centrifuge at 14000 xg for 5 min to pellet the debris.

2.      Precipitate the RNA: Transfer 0.4 ml of cleared lysate to a 1.5-ml tube pre-loaded with 0.4 ml of isopropanol. Vortex for 10 s to mix. Centrifuge at 14000 xg for 5 min to pellet the RNA (DNA are sheared by sonication in the presence of sands, Fig. 1). Decant to discard the supernatant. Rinse the pellet by filling-up the tube with 70% ethanol using a squirt bottle (be sure to rinse the entire interior of the tube, including the cap and the mouth of the tube), and decant to discard the ethanol solution. Repeat the ethanol rinse 3-4 times. Tap the tube on a clean paper towel to remove residual ethanol and air-dry the pellet for 1-2 min.

3.      Solubilize the RNA: Add 0.4 ml nuclease-free water to the pellet, pipet to dislodge the pellet, and then vortex at top speed to fully disperse the pellet. Incubate on ice for 10 min to release the RNA. Centrifuge at 14000 xg for 5 min to pellet the insoluble. Transfer the RNA supernatant to a new 1.5-ml microfuge tube (the RNA solution may appear light yellowish, but it no longer contains RT-PCR inhibitors). The concentration of the RNA/DNA solution may be estimated by diluting 2 ul of the sample with 98 ul of TE buffer (pH 8) for OD260 and OD280 reading and then calculating the concentration using the formula of RNA/DNA concentration (ng/ul) = 50 (dilution factor) x 45 (ng/ul) x OD260. The expected RNA/DNA concentration should be around 450 ng/ul and the total RNA/DNA yield from 0.5 ml of AquaStool preserved stool specimen (~50 mg of feces) should be about 150-200 ug, of which about 1/2 – 1/3 is RNA. Store the RNA solution at –20 or –70 °C.

PCR and RT-PCR Amplification

The most common application of fecal DNA and RNA is to determine if specific DNA or RNA sequences exist in the fecal specimen by PCR genotyping or RT-PCR RNAtyping for the diagnosis of cancers, bacterial, viral, fugal, and parasitic infections; identification of transgenic animals; analysis of human and animal intestinal microbiome; and survey of wildlife animals. However, most fecal DNA and RNA extraction methods are unreliable and often have a PCR failure rate ranging from 20-100%, due to their poor and inefficient DNA/RNA protection, extraction, and PCR inhibitor removal. AquaStool purified fecal DNA and RNA are suitable for various downstream applications. The PCR and RT-PCR protocols provided here may be adjusted for your specific application.

1.      DNase I digestion. AquaStool extracted fecal RNA contains large amount of sheared DNA. RT-PCR can be performed without removing the contaminating DNA, if appropriate primer pair is designed to avoid the amplification of genomic DNA sequence or produce different amplicon size. Otherwise, DNase I treatment is required prior to reverse transcription. To digest the DNA, 40 ul of the 400 ul of AquaStool purified RNA is incubated with 0.5 ul of DNase I in its 1x buffer at 22 °C for 40-60 min (Note: Almost all commercial DNase I products have RNase activity. Using minimal amount of DNase I and incubating at room temperature for extended period helps reduce RNA loss. Even if the DNA digestion is incomplete and there are still a lot of < 250 bp fragments, they would not likely affect your PCR or RT-PCR). Following DNase digestion, the DNase is removed with 4 ul of DNase Inactivation Reagent (Ambion # AM1906).

2.      Reverse transcription. Anneal RT primer to its complimentary RNA by incubating 2 ul of 5 uM RT primer with 4 ul of DNase I treated RNA and 12 ul of nuclease-free water at 80 °C for 4 min and then on ice. Following primer annealing, add 2 ul of 10x buffer (you may use PCR reaction buffer), 0.2 ul of 25 mM dNTPs, and 0.5 ul of 100 U/ul MMLV Reverse Transcriptase to the mix and incubate at 42 °C for 60 min to synthesize the cDNA. Heat-inactivate the MMLV Reverse Transcriptase by incubating at 94°C for 10 min.

3.      PCR amplification. Assemble a 30 ul PCR reaction by mixing 3 ul of 10x PCR reaction buffer (with 2.5 mM MgCl₂), 0.3 ul of 25 mM dNTPs, 2 ul of 5 uM PCR primer pair, 25 ul of nuclease-free water, 0.3 ul of DNA polymerase, and 2.5 ul of the above RT reaction (for RT-PCR) or 0.5 ul of ~200 ng/ul AquaStool purified DNA (for PCR). Run 30 cycles of PCR reaction.

Figure 2. PCR and RT-PCR amplification of fecal DNA and RNA. Human fecal DNA and RNA were extracted with AquaStool. Bacterial, plant (food), and host DNA and RNA in the fecal specimens were analyzed by 30 cycles of PCR and RT-PCR. Lane 1 and 12 are 100 bp DNA ladder; Lane 2 is no DNA/RNA negative control; Lane 3 (PCR), 4 (no RT control), and 5 (RT-PCR) were amplified with a bacterial primer pair (forward primer AGAGTTTGATCCTGGCTCAG and reverse primer GGTTACCTTGTTACGACTT); Lane 6 (PCR), 7 (no RT control), and 8 (RT-PCR) were amplified with a plant primer pair (forward primer GCGTGGACCTGGAATGACTA and reverse primer AGGTTGTATTAAAGTTTCGATCG); Lane 9 (PCR), 10 (no RT control), and 11 (RT-PCR) were amplified with a human primer pair (forward primer TTCCGCAAGTTCACCTACC) and reverse primer CGGGCCGGCCATGCTTTACG). Arrows point at RT-PCR products. The data indicate that it is possible to extract both fecal DNA/RNA with AquaStool for genotyping and RNAtyping of bacterial, food, and host DNA and RNA biomarkers from a single fecal specimen.

---

 

Mouse Fecal DNA/RNA Extraction for Genotyping and RNAtyping

 

AquaStool may be used as a non-invasive method for concurrent extraction of DNA and RNA from a single mouse fecal dropping for genotyping (determination of the genetic status) and RNAtyping (determination of the RNA expression status). It may be used to identify and characterize transgenic animals that not only carry but also express the intended genetic modifications. Timely identifying animals expressing the desired transgene would avoid the production and use of unwanted animals and prevent wasted effort, time, and money. This non-invasive concurrent genotyping and RNAtyping method could become a significant contribution to animal welfare and the transgenic research community.

 

1. Fecal dropping collection: Lift a mouse by its tail from its cage. Mouse often excretes a fecal pellet at the moment it is lifted from the cage or within 1-2 minutes thereafter. Use a clean toothpick to transfer a fresh fecal pellet into a 1.5-ml microfuge tube preloaded with ~50 ug (1/2 scoop with the cap of 0.2 ml PCR tube) of sands (Sigma # 274739, white, 50-70 mesh) and 250 ul of AquaStool. Label the tube with the mouse ID. Remove any additional mouse droppings from the counter before starting the next animal to prevent any chance of fecal ID mislabeling.

 

2. Extract fecal DNA/RNA: Let the fecal pellet soak in AquaStool solution for 15-30 min and vortex at top speed (beadbeating) for 1-2 min to fully homogenize the fecal material (Optional: If you are not interested in fecal RNA, you may incubate the sample at 65 °C for 10-15 min and vortex again for 1 min after the incubation to increase the DNA yield.). Centrifuge at 14,000xg for 5 min to pellet the debris. Transfer the supernatant (~200 ul) to a 0.5-ml microfuge tube and add 200 ul of isopropanol. Vortex for 10 seconds to mix well and centrifuge at 14,000xg for 5 min to pellet the DNA/RNA. Flip the tube to discard the supernatant and fill the tube with 70% ethanol by shooting the ethanol solution at the cap of the tube from a squirt bottle, and then flip to discard the ethanol. Repeat the 70% ethanol rinse 3 times. Tap the tube on a clean paper towel to remove residual ethanol and air-dry the DNA/RNA pellet for 1-2 min. Add 100 ul of nuclease-free water, vortex vigorously (if needed, pipet to dislodge the DNA/RNA pellet) to fully suspend the pellet. Incubate on ice or at 22 °C for 10-15min to solubilize the DNA/RNA. Centrifuge again for 5 minutes to pellet the insoluble and transfer the clear DNA/RNA solution to a new tube. Quantitate the fecal DNA/RNA with a UV spectrophotometer and inspect it by agarose gel electrophoresis.

 

3. PCR genotyping: Set up a 30 ul PCR reaction using 0.5-1 ul of the fecal DNA/RNA and respective primer pair. After a 35 cycles of PCR amplification, separate the PCR products by agarose gel electrophoresis. Save the digital gel image and record the positive or negative PCR amplification result for each fecal sample.

 

4. RT-PCR RNAtyping: Digest the DNA in the fecal DNA/RNA prep by incubating 20 ul of the DNA/RNA with 0.3 ul of Ambion’s Turbo DNase I at 22 °C for 40 min and then inactivate the DNase I with 2 ul of Ambion’s DNase I Removal Reagent. Use 4 ul of the DNase I treated fecal RNA in a 20 ul cDNA synthesis reaction with MMLV Reverse Transcriptase. Subsequently use 3 ul of the cDNA in a 30 ul PCR reaction. After a 35 cycles of PCR amplification, separate the RT-PCR products by agarose gel electrophoresis. Save the digital gel image and record the positive or negative RT-PCR amplification result for each fecal sample.

 

 

Figure 1. Concurrent extraction of fecal DNA and RNA from a single mouse fecal pellet. Mouse fecal DNA/RNA were extracted from a single fecal pellet with AquaStool. 20 ul of the 100 ul fecal DNA/RNA prep was treated with 0.3 ul of Ambion’s Turbo DNase at 22 °C for 40 min. 5 ul of the DNase I digested sample (Lane 3) and 5 ul of the undigested fecal DNA/RNA (Lane 2) were separated in a 0.8% agarose gel electrophoresis. As shown in the gel image, fecal DNA and RNA can be extracted from a single mouse fecal pellet with AquaStool. UV spectrophotometry analysis indicated that the A260/A280 ratio of the extracted fecal DNA/RNA was 1.8 and the DNA/RNA yield was 25 ug/pellet.

 

Lane 1, 10: 100 bp DNA ladder. Lane 2, 6: No DNA/RNA control. Lane 3, 7: PCR amplification. Lane 4, 8: Minus RT control. Lane 5, 9: RT-PCR amplification.

Figure 2. PCR and RT-PCR amplification of AquaStool extracted mouse fecal DNA and RNA. Mouse fecal pellets were collected freshly or stored at room temperatures for 7 days. The AquaStool extracted fecal DNA/RNA were either amplified by PCR (Lane 3 and 7) or by RT-PCR (Lane 5 and 9). PCR amplification was conducted using the primer pair of Rig-S15f (5'-TTCCGCAAGTTCACCTACC) and Rig-S15r (5'-CGGGCCGGCCATGCTTTACG).  The results indicate that mouse feces can be stored at room temperatures up to 7 days without affecting DNA genotyping, however, for RNAtyping the fecal specimens need to be stored at –20 to –70 °C or preserved in AquaStool solution.

 

 

---

 

DNA/RNA Extraction from RNAlater Preserved Fecal Specimen

 

RNAlater® (Ambion) is a widely used preservative for stabilizing biospecimens prior to their DNA and RNA extraction. AquaStool may be used to extract DNA and RNA from RNAlater preserved fecal specimens similar to standard AquaStool protocols, except two important steps. First, prior to extraction, RNAlater should be removed from the specimen as completely as possible. Secondly, DNA and RNA in the cleared lysate should be precipitated with 0.7 volume, instead of the standard 1 volume, of isopropanol. These steps will prevent the highly concentrated salts in RNAlater from interfering DNA and RNA precipitation in isopropanol solution. However, you should note that this protocol is not suitable, if your target is cell-free DNA fragments or viruses in the feces as they will be discarded with RNAlater.

 

1. Centrifuge RNAlater preserved specimen at 14,000xg for 5 min to pellet the fecal materials.

                                                                       

2. Aspirate to remove RNAlater from the specimen as completely as possible.

                                                                                   

3. Add 90-100 ug of white sands and 0.5 ml AquaStool solution to the fecal pellet (~50 mg) in a 1.5-ml microfuge tube. Vortex the tube up side down at top speed for at least 60 s (beadbeating) to fully homogenize the specimen.

                                                                       

4. Incubate tube at 65 °C for 15 min (for fecal DNA extraction) or sonicate at 22 °C for 30 min (for fecal RNA extraction). At the end of the incubation or sonication, vortex again at top speed for 60 s.    

                                                                       

5. Centrifuge at 14,000xg for 5 min to pellet the fecal debris and transfer 0.4 ml clear lysate to a new tube. Add 0.7 vol (i.e., 0.28 ml) of isopropanol to the lysate.

                                                                                   

6. Vortex vigorously for 10 s to mix well and centrifuge at 14,000xg for 5 min to pellet the DNA or RNA (Note: If there are too much RNAlater carryover, you may see two phases and a thin DNA/RNA interphase. In that case, remove the top layer and add 1 ml of 70% ethanol to reprecipitate the DNA or RNA).

 

7. Rinse the DNA or RNA pellet with 70% ethanol 3-4 times by filling up the tube with the ethanol solution from a squirt bottle and then decanting to discard the ethanol solution. Tap the tube on a piece of clean paper towel to remove residual ethanol and air-dry the pellet for 1-2 min.

 

8. Add 200 ul of nuclease-free water to the DNA or RNA pellet. Pipet to dislodge the pellet and vortex vigorously to fully suspend the pellet. Incubate on ice for 10 min and then centrifuge at 14000xg for 5min to pellet the insoluble. Transfer the clear DNA or RNA solution to a new tube and store at –20 to – 70 °C.

 

 

 

---

 

AquaPreserve Protocols

 

The protocol provided is for processing multiple samples simultaneously using a multitube bead beaters, such as Precellys of Bertin Technologies or FastPrep of MP Biomedicals. There are some unique benefits of using a bead beater for tissue homogenization, for example, 1) homogeneous lysis in all specimens can be achieved in as little as 30 seconds, 2) sample-to-sample processing variation is reduced to a minimum, 3) the laborious and hazardous manual homogenization is eliminated, and 4) the tubes are not opened until after homogenization and centrifugation to pellet the tissue debris, and hence, improving biosafety.  However, you may use any pestle-and-tube homogenizer for homogenization and you may also scale up or down the starting material and use different amount of AquaPreserve solution proportionately, for example, 10 mg tissue with 100 ul of AquaPreserve.

 

 

1. Collect the specimen. Approximately 100 mg of fresh (or frozen) animal or plant tissue is transferred into a screw-cap 2-ml microfuge tube containing 1 ml of AquaExtract and a mix of sixty 1.4-mm ceramic beads, six 2.8-mm stainless steel beads, and 100 ug white sands (this bead combination may be used for lysing either animal, plant, or microbial cells). Secure the cap and invert the tube to ensure that the specimen is completely submerged in the AquaExtract solution. The specimen can now be stored at 22 (for at least 1 month), 4 or –20 °C.

 

2. Homogenize the specimens. The specimen tubes are loaded on to a multitube bead beater and homogenized at the maximal speed for 60 seconds.

 

3. Recover the clear lysate. After homogenization, the tubes are centrifuged at 10,000 xg for 5 min to pellet the debris. The cleared lysate (0.2 ml) from each tube is transferred to a corresponding clean 0.6-ml microfuge tube. The remaining 0.8 ml lysate in the 2-ml homogenization tube is saved as backup.

 

4. Precipitate the DNA and RNA. Isopropanol (0.2 ml) is added to each tube containing 0.2 ml cleared lysate (do not incubate the tubes at –20 °C or on ice, which promotes protein precipitation). The samples are vortexed and immediately centrifuged at 10,000 xg for 5 min to pellet the DNA and RNA. The isopropanol supernatant (0.3 ml) from each tube is transferred to a clean 2-ml tube for protein recovery in the next step. The DNA/RNA pellet is rinsed by filling the tube with 70% ethanol and then the ethanol solution is discarded by decanting. The ethanol rinse is repeated 3 times. The DNA/RNA pellet is air-dried and suspended in 0.2 ml nuclease-free water. The solution is centrifuged at 10,000xg for 5 min to pellet any insoluble, and the DNA/RNA solution is transferred to a new tube and stored at 4 °C or at –20 °C for long-term storage.

 

5. Precipitate the proteins. Acetone (1.2 ml) is added to each tube containing 0.3 ml isopropanol supernatant collected in the previous step. The solution is vortexed and centrifuged at 10,000 xg for 5 min to pellet the proteins. The tube is decanted to discard the acetone supernatant into a waste container in a chemical hood. The protein pellet is suspended in 0.2 ml of 1% SDS by scratching the tube across a tube rack rapidly and vortexing. The protein pellet is now completely solubilized and the protein solution is stored at 4 °C or at –20 °C for long-term storage.

 

6. Estimate the DNA/RNA and protein concentrations. DNA/RNA concentration is estimated by diluting 10 ul of the sample with 190 ul of TE buffer (pH 8) for OD260 and OD280 reading and then calculating the concentration using the formula of DNA/RNA concentration (ng/ul) = 20 (dilution factor) x 45 (ng/ul) x OD260. Similarly, protein concentration is estimated by diluting 10 ul of the sample with 190 ul of 1% SDS for OD260 and OD280 reading and then calculating the protein concentration using the formula of protein concentration (mg/ml) = 20 (dilution factor) x [(1.55 x A280) - (0.76 x A260)].